설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTTCAAACATATTTGAGAAGATAGATGAAGAGAATGAGGCAAACTTGCTAGCAGTCCTCACAGAGACACTAGACAGTCTCCCTGTGGATGAAGACGGATTGCCCTCATTTGATGCGCTGACAGATGGAGACGTGACCACTGACAATGAGGCTAGTCCTTCCTCCATGCCTGACGGCACCCCTCCACCCCAGGAGGCAGAAGAGCCGTCTCTACTTAAGAAGCTCTTACTGGCACCAGCCAACACTCAGCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PPARGC1A(10891), PPARGC1A(10891)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
생화학적/생리학적 작용
PPARGC1A (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional regulator which plays a key role in insulin signaling and mitochondrial regulation. It controls metabolism in many organs. For instance, it regulates gluconeogenesis in hepatocytes, thermogenesis in brown adipose tissue, and mitochondrial biogenesis and fatty acid oxidation in the heart. PPARGC1A also attenuates oxidative damage. Mutations in this gene are associated with type 2 diabetes mellitus. It is downregulated in prostate cancer. Presence of PPARGC1A inhibits prostate cancer progression and metastasis. However, presence of this protein gives selective advantages in breast cancer and melanoma cells.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.