Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

View All Documentation

EHU002481

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A10

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTAGCCTGCTTTCCTTGCTAGGCGTGATCTTGGTTCCTATCATTAACCAAGGATGCTTCAAATTCCTTCTTACATTCCTTGTTGCATTAGCTGTAGGAACAATGAGTGGAGACGCCCTTCTTCATCTACTGCCCCATTCTCAGGGTGGACATGATCACAGTCACCAACATGCACATGGGCATGGACATTCTCATGGACATGAATCTAACAAGTTTTTGGAAGAATATGATGCTGTATTGAAAGGACTTGTTGCTCTAGGAGGCATTTACTTGCTATTTATCATTGAACACTGCATTAGAATGTTTAAGCACTACAAACAACAAAGAGGAAAACAGAAATGGTTTATGAAACAGAACACAGAAGAATCAACTATTGGAAGAAAGCTTTCAGATCACAAGTTAAACAATACACCAGATTCTGACTGGCTTCAACTCAAGCC

Ensembl | human accession no.

ENSG00000196950

NCBI accession no.

NM_020342

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC39A10(57181), SLC39A10(57181)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

    • Choose from one of the most recent versions:

    Certificates of Analysis (COA)

    Lot/Batch Number
    ZAV

    Don't see the Right Version?

    If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

    Search for a COA

    Already Own This Product?

    Find documentation for the products that you have recently purchased in the Document Library.

    Visit the Document Library

    Lena K Schroeder et al.
    The Journal of cell biology, 218(1), 83-96 (2018-11-18)
    The endoplasmic reticulum (ER) is composed of interconnected membrane sheets and tubules. Superresolution microscopy recently revealed densely packed, rapidly moving ER tubules mistaken for sheets by conventional light microscopy, highlighting the importance of revisiting classical views of ER structure with
    Mirko Cortese et al.
    Cell host & microbe, 28(6), 853-866 (2020-11-28)
    Pathogenesis induced by SARS-CoV-2 is thought to result from both an inflammation-dominated cytokine response and virus-induced cell perturbation causing cell death. Here, we employ an integrative imaging analysis to determine morphological organelle alterations induced in SARS-CoV-2-infected human lung epithelial cells.
    Xian Yu et al.
    Nature, 594(7864), 560-565 (2021-05-28)
    Myocardial infarction is a major cause of premature death in adults. Compromised cardiac function after myocardial infarction leads to chronic heart failure with systemic health complications and a high mortality rate1. Effective therapeutic strategies are needed to improve the recovery
    David Alejandro Bejarano et al.
    eLife, 8 (2019-01-24)
    Nuclear entry of HIV-1 replication complexes through intact nuclear pore complexes is critical for successful infection. The host protein cleavage-and-polyadenylation-specificity-factor-6 (CPSF6) has been implicated in different stages of early HIV-1 replication. Applying quantitative microscopy of HIV-1 reverse-transcription and pre-integration-complexes (RTC/PIC)
    Anika M Helferich et al.
    Cellular and molecular life sciences : CMLS, 75(23), 4301-4319 (2018-07-22)
    Genetic and functional studies suggest diverse pathways being affected in the neurodegenerative disease amyotrophic lateral sclerosis (ALS), while knowledge about converging disease mechanisms is rare. We detected a downregulation of microRNA-1825 in CNS and extra-CNS system organs of both sporadic
    View All Related Papers

    Articles

    Fluorescent Multiplex Detection using Antibody Atto Dye Conjugates

    Immunoblotting (Western blot transfer) is a common technique in modern proteomics research.

    Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

    Contact Technical Service