Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

View All Documentation

EHU021511

Sigma-Aldrich

MISSION® esiRNA

targeting human CCL2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGAACACTCACTCCACAACCCAAGAATCTGCAGCTAACTTATTTTCCCCTAGCTTTCCCCAGACACCCTGTTTTATTTTATTATAATGAATTTTGTTTGTTGATGTGAAACATTATGCCTTAAGTAATGTTAATTCTTATTTAAGTTATTGATGTTTTAAGTTTATCTTTCATGGTACTAGTGTTTTTTAGATACAGAGACTTGGGGAAATTGC

Ensembl | human accession no.

ENSG00000108691

NCBI accession no.

NM_002982

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCL2(6347) , CCL2(6347)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
OUS
XIS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bin Lu et al.
Molecular medicine reports, 16(3), 3387-3394 (2017-07-18)
Glioma is one of the most common types of tumor of the central nervous system. Increased expression of C‑C motif chemokine 2 (CCL2) has previously been observed in various types of cancer. The effect of CCL2 small interfering (si)RNA on
Chuan Zhou et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(1), 1637-1651 (2020-01-10)
Studies on the effects of transcriptional memory on clone reprogramming in mammals are limited. In the present study, we observed higher levels of active histone H3 lysine 4 trimethylation (H3K4me3 and 5-hydroxymethylcytosine) and repressive (5-methylcytosine) epigenetic modifications in bovine early
Pranabananda Dutta et al.
Breast cancer research and treatment, 170(3), 477-486 (2018-03-30)
Triple-negative breast cancer (TNBC) is the most aggressive type of breast cancer that lacks ER/PR and HER2 receptors. Hence, there is urgency in developing new or novel therapeutic strategies for treatment of TNBC. Our study shows that the Monocyte Chemoattractant
Jung Hwa Ko et al.
Biochemical and biophysical research communications, 494(1-2), 6-12 (2017-10-24)
The cells of the innate immune system, in addition to their capacity to elicit immunity, play a substantial role in immune tolerance induction. Our group has recently shown that a distinct subset of MHC II
Michael Y T Chow et al.
International journal of pharmaceutics, 572, 118818-118818 (2019-11-05)
The development of small interfering RNA (siRNA) formulation for pulmonary delivery is a key to the clinical translation of siRNA therapeutics for the treatment of respiratory diseases. Most inhalable siRNA powder formulations published to date were limited by the siRNA
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service