Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU027151

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCCTCCTGGATACACAGCCCCTCCGATGCAGGGCTGCCCCCGGGAACCGTCACTCATTTCGGCAGCTACAATGTTTCTCGAGCAGCTGGCAATTTCTCCTCTCCAGACGGTACCACCGATGACCCTCTGGGAGGTCATACCGTCTGGCAAGTGGTCTTCATCGCTTTCTTAACGGGCATCCTGGCCTTGGTGACCATCATCGGCAACATCCTGGTAATTGTGTCATTTAAGGTCAACAAGCAGCTGAAGACGGTCAACAACTACTTCCTCTTAAGCCTGGCCTGTGCCGATCTGATTATCGGGGTCATTTCAATGAATCTGTTTACGACCTACATCATCATGAATCGATGGGCCTTAGGGAACTTGGCCTGTGACCTCTGGCTTGCCATTGACTACGTAGCCAGCAATGCCTCTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lulu Farhana et al.
Stem cell research & therapy, 7(1), 181-181 (2016-12-03)
Although the unconjugated secondary bile acids, specifically deoxycholic acid (DCA) and lithocholic acid (LCA), are considered to be risk factors for colorectal cancer, the precise mechanism(s) by which they regulate carcinogenesis is poorly understood. We hypothesize that the cytotoxic bile
Zhenhua Shang et al.
Neurourology and urodynamics, 38(2), 615-624 (2018-12-15)
To investigate the effects of injecting RNA interference (RNAi) lentiviruses targeting the muscarinic 3 (M3 ) receptor gene into the bladder wall on bladder activity in rats with spinal cord injury (SCI). Four M3 RNAi lentiviruses were constructed and used
Mahmoud Mona et al.
International journal of molecular sciences, 20(3) (2019-02-15)
Sjögren's syndrome (SjS) is an autoimmune disease that destroys the salivary glands and results in severe dry mouth. Mesenchymal stem cell (MSC) transplantation has been recently proposed as a promising therapy for restoring cells in multiple degenerative diseases. We have
Huangfei Yu et al.
Scientific reports, 7, 40802-40802 (2017-01-20)
Acetylcholine (ACh), known as a neurotransmitter, regulates the functions of numerous fundamental central and peripheral nervous system. Recently, emerging evidences indicate that ACh also plays an important role in tumorigenesis. However, little is known about the role of ACh in
Fenglin Sun et al.
Phytotherapy research : PTR, 33(5), 1551-1561 (2019-05-09)
Aacacetin, a plant flavone has shown antitumor efficacy recently. However, its associated mechanisms are poorly known. We hypothesized that the muscarinic M3 receptor (M3 R), which is highly expressed in some cancer tissue, is related to the antitumor effect of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service