Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU064911

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL4B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGCAACTGGAATAGAGGATGGAGAGTTAAGGAGAACACTGCAGTCATTAGCCTGTGGCAAAGCTAGAGTTCTGGCGAAAAATCCAAAGGGCAAAGACATTGAAGATGGTGACAAGTTCATTTGTAATGATGATTTCAAACATAAACTTTTCAGGATAAAGATCAATCAAATCCAGATGAAAGAAACGGTTGAAGAACAAGCAAGCACTACAGAAAGAGTATTTCAAGACAGACAGTATCAAATTGATGCTGCAATTGTTCGAATTATGAAGATGAGAAAGACACTTAGCCACAATCTCCTTGTTTCAGAAGTGTACAACCAGTTGAAATTTCCAGTAAAGCCTGCTGATCTTAAGAAGAGAATAGAATCTTTAATTGACCGGGACTACATGGAAAGAGATAAAGAAAATCCAAACCAGTACAACTATATTGCATAGAATGTTGGCCTTGCAGCATTTGGTGTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anbarasu Kumaraswamy et al.
The Journal of biological chemistry, 293(40), 15691-15705 (2018-08-25)
c-Myc is a proto-oncogene controlling expression of multiple genes involved in cell growth and differentiation. Although the functional role of c-Myc as a transcriptional regulator has been intensively studied, targeting this protein in cancer remains a challenge. Here, we report
Ye Lin et al.
Epigenetics & chromatin, 12(1), 22-22 (2019-04-18)
Neural tube defects (NTDs) are common birth defects involving the central nervous system. Recent studies on the etiology of human NTDs have raised the possibility that epigenetic regulation could be involved in determining susceptibility to them. Here, we show that
Mingfeng Zhao et al.
The Prostate, 79(5), 480-488 (2019-01-05)
Cullin 4B (CUL4B), a scaffold protein that assembles CRL4B ubiquitin ligase complexes, is overexpressed in many types of solid tumors and contributes to epigenetic silencing of tumor suppressors. However, its clinical significance and underlying molecular mechanisms in prostate cancer (PCa)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service