Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU074571

Sigma-Aldrich

MISSION® esiRNA

targeting human VHL

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCTGGAAGACCACCCAAATGTGCAGAAAGACCTGGAGCGGCTGACACAGGAGCGCATTGCACATCAACGGATGGGAGATTGAAGATTTCTGTTGAAACTTACACTGTTTCATCTCAGCTTTTGATGGTACTGATGAGTCTTGATCTAGATACAGGACTGGTTCCTTCCTTAGTTTCAAAGTGTCTCATTCTCAGAGTAAAATAGGCACCATTGCTTAAAAGAAAGTTAACTGACTTCACTAGGCATTGTGATGTTTAGGGGCAAACATCACAAAATGTAATTTAATGCCTGCCCATTAGAGAAGTATTTATCAGGAGAAGGTGGTGGCATTTTTGCTTCCTAGTAAGTCAGGACAGCTTGTATGTAAGGAGGTTTGTATAAGTAATTCAGTGGGAATTGCAGCATA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jie Hao et al.
Neurochemical research, 41(9), 2391-2400 (2016-06-22)
The VHL (Von Hippel-Lindau) gene is a tumor suppressor gene, which is best known as an E3 ubiquitin ligase that negatively regulates the hypoxia inducible factor. The inactivation of VHL gene could result in the abnormal synthesis of VHL protein
Susan E Scanlon et al.
Oncotarget, 9(4), 4647-4660 (2018-02-13)
The von Hippel-Lindau (
Dawei Li et al.
Free radical biology & medicine, 110, 102-116 (2017-06-07)
Oxidative stress has a critical role in the pathogenesis of acetaminophen (APAP) induced hepatocellular necrosis, and the identification of novel approaches to attenuate oxidative stress is essential to prevent/revert the disease. This study investigated the role of both HIF-1 and
Mian Wei et al.
Journal of cellular physiology, 234(10), 17392-17404 (2019-02-23)
Microenvironmental hypoxia-mediated drug resistance is responsible for the failure of cancer therapy. To date, the role of the hedgehog pathway in resistance to temozolomide (TMZ) under hypoxia has not been investigated. In this study, we discovered that the increasing hypoxia-inducible
Joan Fernandez Esmerats et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(3), 467-481 (2019-01-04)
Objective- Calcific aortic valve (AV) disease, characterized by AV sclerosis and calcification, is a major cause of death in the aging population; however, there are no effective medical therapies other than valve replacement. AV calcification preferentially occurs on the fibrosa

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service