Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU126851

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR5

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAG

Ensembl | human accession no.

ENSG00000160791

NCBI accession no.

NM_000579

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCR5(1234) , CCR5(1234)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
WQS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Silvia Waldeck et al.
Molecular oncology, 14(4), 779-794 (2020-01-20)
FLT3-ITD tyrosine kinase inhibitors (TKI) show limited clinical activity in acute myeloid leukemia (AML) due to emerging resistance. TKI resistance is mediated by secondary FLT3-ITD mutations only in a minority of cases. We hypothesize that the cytokine CCL5 protects AML
Ying Wang et al.
Oncology reports, 36(6), 3522-3528 (2016-10-18)
Glioblastoma (GBM) is a highly malignant brain tumor characterized by invasion tendency. Macrophage infiltration is associated with GBM invasion, but the mechanisms remain unclear. Hypoxia is an outstanding characteristic of GBM tissue. Hypoxia microenvironment modulates the biological behaviors of both tumor
Ji Hoon Phi et al.
PloS one, 12(1), e0169714-e0169714 (2017-01-11)
The etiology and pathogenesis of moyamoya disease (MMD) are still obscure. Previous studies indicated that angiogenic chemokines may play an important role in the pathogenesis of the disease. Recently, it was discovered that peripheral blood-derived endothelial colony-forming cells (ECFCs) and
Shen Pang et al.
PloS one, 9(5), e96445-e96445 (2014-05-17)
The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression.
Takayuki Kodama et al.
Laboratory investigation; a journal of technical methods and pathology, 100(9), 1140-1157 (2020-05-28)
Tumor-associated macrophages (TAMs) contribute to the progression and mortality of various malignancies. We reported that high numbers of infiltrating TAMs were significantly associated with tumor progression and poor prognosis in esophageal squamous cell carcinoma (ESCC). In our previous investigation of
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service