description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTCCTTCATCTTGGCCATCCCGGAAGCAATCGGCTTCGTCATGGTACCCTTCGAATACAAGGGCGAGCTGCATAGGACCTGCATGCTCAACGCCACGTCCAAGTTCATGGAGTTTTACCAAGATGTGAAGGACTGGTGGCTCTTTGGGTTCTACTTCTGCATGCCCTTGGTGTGCACAGCAATCTTCTACACCCTCATGACCTGTGAGATGCTCAACAGGAGGAACGGCAGCTTGCGGATCGCCCTTAGTGAGCACCTCAAACAGCGTCGAGAAGTGGCAAAGACTGTCTTCTGCTTGGTTGTCATCTTCGCCCTGTGCTGGTTCCCTCTTCACTTAAGCCGCATTTTGAAGAAAACTGTATATGATGAGATGGATAAGAACCGGTGTGAACTGCTCAGCTTCTTGCTGCTA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... EDNRA(13617), Ednra(13617)
Related Categories
1 of 2
This Item | WH0010068M5 |
---|---|
biological source human | biological source mouse |
assay ≥90% (SDS-PAGE) | assay - |
recombinant expressed in E. coli | recombinant - |
concentration 1 mg/mL | concentration - |
mol wt 20 kDa (187 aa, 31-194 aa + His Tag) | mol wt - |
form liquid | form buffered aqueous solution |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Articles
Tips and tricks for using the Millicell® Cloud Application to analyze data from the Millicell® DCI digital cell imager.
Discover the answers to your questions about using the Millicell® DCI Digital Cell Imager, counting cells, and measuring cell confluency and morphology.
Cell validation data using the Millicell® DCI Digital Cell Imager for confluency determination and estimated cell counts.
Related Content
Streamline TEER data capture and analysis with user-friendly enhancements including an intuitive touchscreen interface, standing in-well probe, and automatic data logging.
Intuitive lab instruments, ergonomic tools, accessible data, and forward-thinking solutions for research, biotech, and pharma laboratories.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service