EMU021341
MISSION® esiRNA
targeting mouse Fundc1
Select a Size
CA$241.00
Select a Size
About This Item
CA$241.00
Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTTCAGGTTGCCAGTCACAGTGGCTATGTACAGATCGACTGGAAGAGAGTTGAAAAAGATGTAAACAAAGCAAAGAGACAGATAAAGAAGCGAGCAAATAAAGCAGCACCTGAAATCAACAATATAATTGAAGAAGCAACAGACTTTATCAAGCAGAACATTGTGATATCCAGCGGCTTCGTGGGAGGCTTTTTGCTAGGCCTGGCATCTTAAGGACTTGAAGGCTCTATGGTAGTGGATCCAACAATGAGAGGAAGACTGTGGCAGCAGGGTTATCTCTTAATGGCACATGCTACCAGTCTCCAAAGTAAGGAACAGCCGGCTGGACGATTGCAAATGAAGCAGCTTAGCATTTTGCCGCCTGAAGCTTACCAAGCTAGTATCTCCTGTAAGACAACCTATGTGCTGTGTACACAATAGTATTCTTGAGCAACCATGGATTT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... FUNDC1(72018), Fundc1(72018)
1 of 4
This Item | CLS430421 | CLS431143 | CLS431144 |
|---|---|---|---|
| manufacturer/tradename Corning 430183 | manufacturer/tradename Corning 430421 | manufacturer/tradename Corning 431143 | manufacturer/tradename Corning 431144 |
| sterility sterile | sterility sterile | sterility sterile | sterility sterile |
| material clear polycarbonate flask, flat cap, wide-mouth , flat bottom flask, wide-mouth neck, polypropylene cap (Easy-Grip flat) | material clear polycarbonate flask, flat bottom flask, flat cap, polypropylene cap (Easy-Grip flat), wide-mouth , wide-mouth neck | material clear polycarbonate flask, flat bottom flask, polypropylene cap (Easy-Grip vent), vent cap, wide-mouth , wide-mouth neck | material clear polycarbonate flask, flat bottom flask, polypropylene cap (Easy-Grip vent), vent cap, wide-mouth , wide-mouth neck |
| feature disposable, no baffles, cap, graduations 25 mL | feature cap, disposable, graduations 25 mL, no baffles | feature cap, disposable, graduations 25 mL, no baffles | feature disposable, graduations 25 mL, with cap, no baffles |
| packaging pack of 1, case of 50 | packaging pack of 1, case of 50 | packaging pack of 1, case of 50 | packaging pack of 1, case of 50 |
| flask capacity 250 mL | flask capacity 125 mL | flask capacity 125 mL | flask capacity 250 mL |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service