description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGAAGCAGTTGGTGTGAAGAAAAGTGTCAAATACGAAGCTGCTGGAGAAGCTGTAAAGACCCTCAAAAAGACCCAGCCGACTGTCATTAACAACTTGAAGAAAGGGACTGTTGAAGATGTGATTTCAAGAAATGAAATCCAGGGCCGCTCAGCAGAAGAAGCTTACAAACAGCAAATCAAAGAAGACAACATAGGGAATCAACTGCTGAGAAAGATGGGCTGGACGGGTGGTGGTTTAGGGAAATCTGGTGAGGGCATACGGGAGCCTATCTCAGTTAAAGAGCAGCATAAGCGAGAAGGCCTTGGTCTAGATGTAGAGAGGGTCAATAAAATTGCTAAGAGGGATATAGAACAAATTATCAGAAACTATGCCCGCTCTGAAAGCCACTCAGATTTGACCTTCTCCACGGA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... NKRF(77286), Nkrf(77286)
1 of 4
This Item | HPA035536 | WH0283455M1 | HPA035491 |
---|---|---|---|
antibody form affinity isolated antibody | antibody form affinity isolated antibody | antibody form purified immunoglobulin | antibody form affinity isolated antibody |
conjugate unconjugated | conjugate unconjugated | conjugate unconjugated | conjugate unconjugated |
Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level 100 |
biological source rabbit | biological source rabbit | biological source mouse | biological source rabbit |
product line Prestige Antibodies® Powered by Atlas Antibodies | product line Prestige Antibodies® Powered by Atlas Antibodies | product line - | product line Prestige Antibodies® Powered by Atlas Antibodies |
clone polyclonal | clone polyclonal | clone 6F12, monoclonal | clone polyclonal |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service