Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU082001

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myh3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATGGTGGATGTGGAAAGAGCCAACTCCCTGGCTGCCGCTCTGGACAAGAAGCAGAGGAACTTTGACAAGGTGCTAGCTGAGTGGAAGACGAAGTGTGAGGAGAGCCAAGCCGAGCTGGAGGCAGCTCTCAAGGAATCCCGGTCCTTGAGCACTGAGCTCTTCAAACTGAAGAATGCCTATGAAGAAGCCTTGGATCAACTTGAAACCGTGAAACGGGAGAATAAGAACTTAGAACAAGAGATAGCAGATCTCACTGAACAGATTGCCGAGAACGGTAAAAGCATCCATGAGCTAGAGAAATCCAGAAAACAGATGGAGCTGGAGAAGGCTGACATCCAGATGGCGCTGGAGGAAGCAGAGGCAGCTCTTGAGCACGAAGAAGCCAAGATTCTCCGGATCCAGCTTGAACTGACCCAGGTGAAATCAGAGATTGATAGGAAGATTGCAGAGAAGGATGAAGAGATCGAGCAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A SCN10A SNP biases human pain sensitivity.
Duan G, et al.
Molecular Pain, 12, 1744806916666083-1744806916666083 (2016)
John N Wood et al.
Journal of neurobiology, 61(1), 55-71 (2004-09-14)
Acute, inflammatory, and neuropathic pain can all be attenuated or abolished by local treatment with sodium channel blockers such as lidocaine. The peripheral input that drives pain perception thus depends on the presence of functional voltage-gated sodium channels. Remarkably, two
William A Catterall et al.
Pharmacological reviews, 55(4), 575-578 (2003-12-06)
This summary article presents an overview of the molecular relationships among the voltage-gated sodium channels and a standard nomenclature for them, which is derived from the IUPHAR Compendium of Voltage-Gated Ion Channels. The complete Compendium, including data tables for each
Channelopathy-related SCN10A gene variants predict cerebellar dysfunction in multiple sclerosis.
Roostaei T, et al.
Neurology, 86(5), 410-417 (2016)
Tomislav Kokotović et al.
Frontiers in molecular neuroscience, 14, 720973-720973 (2021-10-15)
PR domain-containing member 12 (PRDM12) is a key developmental transcription factor in sensory neuronal specification and survival. Patients with rare deleterious variants in PRDM12 are born with congenital insensitivity to pain (CIP) due to the complete absence of a subtype

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service