Skip to Content
MilliporeSigma

Skip To

EMU069861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myt1

Sign Into View Organizational & Contract Pricing

Select a Size

100 MG
₩420,007
250 MG
₩863,765

₩420,007


Please contact Customer Service for Availability

Select a Size

Change View
100 MG
₩420,007
250 MG
₩863,765

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₩420,007


Please contact Customer Service for Availability

Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGCTGGAGAATGATGAGGAGATCAAGCAGCTAAATCAGGAGATACGAGACTTAAATGAGTCCAATTCGGAAATGGAGGCTGCCATGGTGCAGCTGCAGTCTCAGATCTCGTCCATGGAGAAGAACCTGAAGAACATCGAGGAGGAGAACAAGCTCATTGAGGAGCAGAATGAGGCCCTGTTTCTGGAATTGTCCGGGCTTAGCCAAGCCCTCATCCAAAGTCTTGCCAATATTCGCCTTCCACACATGGAACCAATATGTGAACAGAATTTTGACGCCTATGTGAACACCCTCACTGACATGTACTCCAATCAGGACTGCTACCAGAATCCGGAGAACAAAGGCCTTCTGGAAACGATCAAGCAAGCTGTGAGGGGCATTCAGGTCTAGGCTGCACTGCACACAGGAGTCTGCTCTGCTCCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wesley Mah et al.
The American journal of pathology, 187(8), 1717-1735 (2017-06-24)
Compared to skin, wound healing in oral mucosa is faster and produces less scarring, but the mechanisms involved are incompletely understood. Studies in mice have linked high expression of CD26 to a profibrotic fibroblast phenotype, but this has not been
Wesley Mah et al.
The American journal of pathology, 187(8), 1717-1735 (2017-06-24)
Compared to skin, wound healing in oral mucosa is faster and produces less scarring, but the mechanisms involved are incompletely understood. Studies in mice have linked high expression of CD26 to a profibrotic fibroblast phenotype, but this has not been

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service