Skip to Content
MilliporeSigma

Skip To

ZMS1020

Sigma-Aldrich

Anti-Influenza A Nucleoprotein Antibody, clone A1 ZooMAb® Mouse Monoclonal

enhanced validation
greener alternative

recombinant, expressed in HEK 293 cells

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
12352203
NACRES:
NA.43
Pricing and availability is not currently available. Contact Technical Service
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

biological source

mouse

Quality Level

recombinant

expressed in HEK 293 cells

conjugate

unconjugated

antibody form

purified antibody

antibody product type

primary antibodies

clone

A1, recombinant monoclonal

description

recombinant, expressed in HEK 293 cells

product line

ZooMAb® learn more

form

lyophilized

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU028371EHU009861EHU055321
Ensembl | human accession no.

ENSG00000102858

Ensembl | human accession no.

ENSG00000085788

Ensembl | human accession no.

ENSG00000112159

Ensembl | human accession no.

ENSG00000103740

Gene Information

human ... MGRN1(23295), MGRN1(23295)

Gene Information

human ... DDHD2(23259), DDHD2(23259)

Gene Information

human ... MDN1(23195), MDN1(23195)

Gene Information

human ... ACSBG1(23205), ACSBG1(23205)

esiRNA cDNA target sequence

ACCATCTACTGCCAGGCATCGGAGGAGTTCCTGAACGGCAGGGCAGTATACAGCCCCAAGAGCCCCTCGCTACAGTCCGAGACCGTCCACTACAAGAGAGGGGTGAGCCAGCAGTTCTCCCTGCCCTCCTTCAAGATTGACTTCTCGGAATGGAAGGATGACGAGCTGAACTTTGACCTGGACCGGGGCGTGTTTCCAGTAGTCATCCAGGCTGTGGTGGACGAAGGAGATGTGGTGGAAGTGACTGGCCACGCCCACGTGCTCTTGGCTGCCTTTGAAAAGCACATGGACGGCAGCTTCTCTGTGAAGCCTTTAAAGCAGAAGCAAATTGTGGACCGGGTCAGCTACCTCCTGCAGGAGATCTATGGCATTGAGAACAAGAACAACCAGGAGACCAAGCCCTCGGACGACGAGAACAGCGACAACAGCAA

esiRNA cDNA target sequence

TAACCCTGCCCAGCATTAACCGCCTCAGGCACTTCACCAATGACACAATTCTGGATGTCTTCTTCTACAATAGTCCCACCTACTGTCAGACTATTGTGGACACAGTTGCTTCTGAAATGAACCGAATATACACACTTTTTCTACAGAGGAACCCTGATTTCAAAGGGGGTGTATCCATTGCTGGTCATAGTTTAGGTTCGCTTATATTGTTTGATATCCTAACAAATCAGAAAGATTCTTTGGGGGATATTGACAGTGAAAAGGATTCGCTAAATATTGTAATGGATCAAGGAGATACACCTACACTAGAGGAAGATTTGAAGAAACTTCAGCTCTCTGAATTCTTTGATATCTTTGAGAAGGAGAAAGTAGATAAGGAAGCTCTGGCTTTATGTACAGACCGAGATCTTCAGGAAA

esiRNA cDNA target sequence

TGTCAACCTGTGCTTCAAGGTTTCTCAGAGGCTGTCAGTCACTTGCTACAGGACTGGCCAGAACACCCAGCGCTTGAACAGCTCCTGGTTGTAATGGACAGAATTCGTAGTTTCCCACTTTCCAGTCCCATCTCAAAGTTCCTGAATGGCTTAGAGATCCTTCTGGCAAAGGCACAGGATTGGGAGGAAAATGCAAGTCGAGCTTTGTCTTTGCGGAAACATCTTGATTTGATCAGTCAGATGATCATTCGGTGGCGTAAACTGGAGCTGAACTGCTGGTCCATGAGTTTGGATAATACTATGAAGCGCCACACCGAGAAATCCACCAAGCACTGGTTCTCCATCTATCAGATGCTTGAGAAGCACATGCAGGAACAAACAGAAGAACAGGAAGATGACAAACAGATGACCTTGATGTTGCTGGTCAGCACATTACAAGCATTTATTGAAGGATCCTCGCTGGGAGAGTTCCATGTGCGACTTCAGATGTTACTGGTTTTCCATTGTCATGTCTTGCTGATGCCACAG

esiRNA cDNA target sequence

AAGTTCCTGTCCATGCTGCTCACCTTGAAGTGCACTCTGGACCCAGACACCTCTGACCAGACTGATAATCTGACTGAACAAGCTATGGAGTTCTGCCAGAGGGTGGGCAGCAGAGCCACCACAGTGTCCGAGATCATAGAGAAGAAGGATGAGGCCGTGTACCAGGCCATCGAAGAGGGGATCCGGAGGGTCAACATGAACGCGGCGGCCCGGCCCTACCACATCCAGAAGTGGGCCATTCTCGAGAGAGACTTCTCCATTTCGGGTGGAGAGTTGGGTCCCACGATGAAACTGAAACGGCTCACAGTTTTGGAGAAGTACAAAGGTATCATTGACTCCTTTTACCAAGAGCAAAAAATGTAATCAGGGCCTATGCCTGCAGTTTCTATAGAATAGAGGGCAGGCGTTCCGAGCCTCTTCCTGAGCCCCAGGTCTCTTCAGTCTGGGC

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_001142289

NCBI accession no.

NM_015214

NCBI accession no.

NM_014611

NCBI accession no.

NM_015162

General description

We are committed to bringing you greener alternative products, which adhere to one or more of The 12 Principles of Green Chemistry.This antibody is Preservative-free, produced without the harm or sacrifice of animals and exceptionally stable to allow for ambient shipping and storage if needed and thus aligns with "Waste Prevention", "Designing Safer Chemicals" and "Design for Energy Efficiency". Click here for more information.
ZooMAb® antibodies represent an entirely new generation of recombinant monoclonal antibodies.

Each ZooMAb® antibody is manufactured using our proprietary recombinant expression system, purified to homogeneity, and precisely dispensed to produce robust and highly reproducible lot-to-lot consistency. Only top-performing clones are released for use by researchers. Each antibody is validated for high specificity and affinity across multiple applications, including its most commonly used application. ZooMAb® antibodies are reliably available and ready to ship when you need them.

Learn more about ZooMAb here.

Specificity

Clone A1 is a ZooMAb® mouse recombinant monoclonal antibody that detects Nucleoprotein N1 of Influenza A virus.

Immunogen

Influenza A virus

Application

Quality Control Testing

Evaluated by Immunocytochemistry in MDCK cells infected with Influenza A virus.

Immunocytochemistry Analysis: A 1:100 dilution of this antibody detected Influenza A Nucleoprotein in MDCK cells infected with Influenza A virus.

Tested applications

ELISA Analysis: 1.0 μg/mL from a representative lot detected recombinant Influenza A virus Nucleoprotein.

Affinity Binding Assay: A representative lot of this antibody bound recombinant Influenza A Nucleoprotein with a KD of 2.8 x 10-6 in an affinity binding assay.

Note: Actual optimal working dilutions must be determined by end user as specimens, and experimental conditions may vary with the end user
Anti-Influenza A Nucleoprotein, clone A1 ZooMAb®, Cat. No. ZMS1020, is a recombinant Mouse monoclonal antibody that detects Influenza A virus nucleoprotein and is tested for use in Affinity Binding Assay, ELISA, and Immunocytochemistry.

Target description

Nucleoprotein (UniProt: P03466; also known as Nucleocapsid protein, Protein N) is encoded by the NP gene (Gene ID: 956531) in Influenza A virus. Influenza A viruses belong to the Orthomyxoviridae family and encapsidates the negative strand viral RNA that protects it from the action of nucleases. Its envelope membrane is reported to carry hemagglutinin, neuraminidase, and the ion channel protein M2. Inside the membrane there are layers of matrix protein 1 and ribonucleoprotein (RNP) complexes that contain viral RNA and binding proteins. RNP serves as template for transcription and replication and must be localized in the host cell nucleus to start an infectious cycle. However, due to its large size, RNP cannot diffuse through the nuclear pore complex and is transported through CRM-1-dependent nuclear export machinery. Viral nucleoprotein contains two nuclear localization signals (NLS) that are responsible for active RNP import into the nucleus. It has been reported that M1 interaction with RNP hides nucleoprotein′s NLS and soon after a virion infects a new cell, M1 dissociates from the RNP under acidification of the virion driven by M2 protein. This dissociation of M1 from RNP unmasks nucleoprotein′s NLS, targeting the RNP to the nucleus. This ZooMAb® recombinant monoclonal antibody, generated by our propriety technology, offers significantly enhanced specificity, affinity, reproducibility, and stability over conventional monoclonals.

Physical form

Purified recombinant mouse monoclonal antibody IgG, lyophilized in PBS, 5% Trehalose, normal appearance a coarse or translucent resin. The PBS/trehalose components in the ZooMAb formulation can have the appearance of a semi-solid (bead like gel) after lyophilization. This is a normal phenomenon. Please follow the recommended reconstitution procedure in the data sheet to dissolve the semi-solid, bead-like, gel-appearing material. The resulting antibody solution is completely stable and functional as proven by full functional testing. Contains no biocide or preservatives, such as azide, or any animal by-products. Larger pack sizes provided as multiples of 25 μL.

Reconstitution

Reconstitute lyophilized antibody pellet with 25μL of ultrapure water or Phosphate Buffered Saline (PBS). Please refer to our reconstitution protocol and the specific application guidance on the suggested starting dilutions and sample type.

Storage and Stability

Recommend storage of lyophilized product at 2-8°C; Before reconstitution, micro-centrifuge vials briefly to spin down material to bottom of the vial; Reconstitute each vial by adding 25 μL of filtered lab grade water or PBS; Reconstituted antibodies can be stored at 2-8°C, or -20°C for long term storage. Avoid repeated freeze-thaws.

Legal Information

ZooMAb is a registered trademark of Merck KGaA, Darmstadt, Germany

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

11 - Combustible Solids

WGK

WGK 1


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Karen Legler et al.
British journal of cancer, 118(6), 847-856 (2018-01-31)
Alterations in protein glycosylation have been related to malignant transformation and tumour progression. We recently showed that low mRNA levels of Golgi alpha-mannosidase MAN1A1 correlate with poor prognosis in breast cancer patients. We analysed the role of MAN1A1 on a
Min Deng et al.
Molecular medicine reports, 20(1), 368-374 (2019-05-23)
The activation of hepatic stellate cells (HSCs) is considered associated with liver fibrosis. However, the exact role of syndecan‑1 (SDC1), a protein that regulates the interaction between cells and the microenvironment, in the activation of HSCs resulting in liver fibrosis
Hao Gao et al.
Cell cycle (Georgetown, Tex.), 18(12), 1393-1406 (2019-05-28)
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential
Deepak Chhangani et al.
Biochimica et biophysica acta, 1842(9), 1472-1484 (2014-04-29)
Polyglutamine diseases are a family of inherited neurodegenerative diseases caused by the expansion of CAG repeats within the coding region of target genes. Still the mechanism(s) by which polyglutamine proteins are ubiquitinated and degraded remains obscure. Here, for the first

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service