Skip to Content
Merck
All Photos(1)

Key Documents

EHU154411

Sigma-Aldrich

MISSION® esiRNA

targeting human AHCY

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCAAGCTGAATGTGAAGTTGACCAAGCTAACTGAGAAGCAAGCCCAGTACCTGGGCATGTCCTGTGATGGCCCCTTCAAGCCGGATCACTACCGCTACTGAGAGCCAGGTCTGCGTTTCACCCTCCAGCTGCTGTCCTTGCCCAGGCCCCACCTCTCCTCCCTAAGAGCTAATGGCACCAACTTTGTGATTGGTTTGTCAGTGTCCCCCATCGACTCTCTGGGGCTGATCACTTAGTTTTTGGCCTCTGCTGCAGCCGTCATACTGTTCCAAATGTGGCAGCGGGAACAGAGTACCCTCTTCAAGCCCCGGTCATGATGGAGGTCCCAGCCACAGGGAACCATGAGCTCAGTGGTCTTGGAACAGCTCACTAAGTCAGTCCTTCCTTAGCCTGGAAGTCAGTAGTGGAGTCACAAAGCCCATGTGTTTTGCCATCTAGGCCTTCACCTGGTCTGTGGACTTATACCTGTGTGCTTGGTTTACAGGTCCAGTGGTTCTTCAGCCCATGACAGATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AHCY(191), AHCY(191)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

V K Chaithanya Ponnaluri et al.
Journal of molecular biology, 430(14), 2051-2065 (2018-05-15)
DNA (cytosine-5) methyltransferase 1 (DNMT1) is essential for mammalian development and maintenance of DNA methylation following DNA replication in cells. The DNA methylation process generates S-adenosyl-l-homocysteine, a strong inhibitor of DNMT1. Here we report that S-adenosylhomocysteine hydrolase (SAHH/AHCY), the only
Carolina Magdalen Greco et al.
Science advances, 6(51) (2020-12-18)
Circadian gene expression driven by transcription activators CLOCK and BMAL1 is intimately associated with dynamic chromatin remodeling. However, how cellular metabolism directs circadian chromatin remodeling is virtually unexplored. We report that the S-adenosylhomocysteine (SAH) hydrolyzing enzyme adenosylhomocysteinase (AHCY) cyclically associates
Sae Jeong Park et al.
American journal of cancer research, 5(7), 2127-2138 (2015-09-04)
S-adenosylhomocysteine hydrolase (AHCY) hydrolyzes S-adenosylhomocysteine to adenosine and l-homocysteine, and it is already known that inhibition of AHCY decreased cell proliferation by G2/M arrest in MCF7 cells. However, the previous study has not indicated what mechanism the cell cycle arrest

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service