추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGATGCAGAAGCCATTTGAAGACGCCTCGTTTGCGCTGCGGACGGGGGAGATGAGCGGGCCCGTGTTCACGGATTCCGGCATCCACATCATCCTCCGCACTGAGTGAGGGTGGGGAGCCCAGGCCTGGCCTCGGGGCAGGGCAGGGCGGCTAGGCCGGCCAGCTCCCCCTTGCCCGCCAGCCAGTGGCCGAACCCCCCACTCCCTGCCACCGTCACACAGTATTTATTGTTCCCACAATGGCTGGGAGGGGGCCCTTCCAGATTGGGGGCCCTGGGGTCCCCACTCCCTGTCCATCCCCAGTTGGGGCTGCGACCGCCAGATTCTCCCTTAAGGAATTGACTTCAGCAGGGGTGGGAGGCTCCCAGACCCAGGGCAGTGTGGTGGGAGGGGTGTTCCAAAGAGAAGGCCTGGTCAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PIN1(5300), PIN1(5300)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Ryuhei Kanaoka et al.
PloS one, 10(6), e0127467-e0127467 (2015-06-04)
Prostate cancer initially develops in an androgen-dependent manner but, during its progression, transitions to being androgen-independent in the advanced stage. Pin1, one of the peptidyl-prolyl cis/trans isomerases, is reportedly overexpressed in prostate cancers and is considered to contribute to accelerated
Manish Mishra et al.
Antioxidants & redox signaling, 30(13), 1621-1634 (2018-08-15)
Diabetes increases oxidative stress in the retina and dysfunctions their mitochondria, accelerating capillary cell apoptosis. A 66 kDa adaptor protein, p66Shc, is considered as a sensor of oxidative stress-induced apoptosis. In the pathogenesis of diabetic retinopathy, a progressive disease, reactive oxygen
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.