설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCTGTGGGCCTGACTACTACGAAGTGGAAGAAGATGGCATCCGCAAGTGTAAAAAATGTGATGGGCCCTGTCGCAAAGTTTGTAATGGCATAGGCATTGGTGAATTTAAAGACACACTCTCCATAAATGCTACAAACATCAAACACTTCAAATACTGCACTGCCATCAGCGGGGACCTTCACATCCTGCCAGTGGCCTTTAAGGGGGATTCTTTCACGCGCACTCCTCCTCTAGACCCACGAGAACTAGAAATTCTAAAAACCGTAAAGGAAATAACAGGCTTTTTGCTGATTCAGGCTTGGCCTGATAACTGGACTGACCTCCATGCTTTCGAGAACCTAGAAATAATACGTGGCAGAACAAAGCAACATGGTCAGTTTTCTTTGGCGGTCGTTGGCCTGAACATCACATCACTGGGGCTGCGTTCCCTCAAGGAGATCAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... EGFR(13649), Egfr(13649)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Began Gopalan et al.
Biomaterials, 35(26), 7479-7487 (2014-06-11)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed lethal cancers in the world. We previously showed two imidazolium salts (IBN-1 and IBN-9) with a moderate efficacy for HCC. Here we report a more potent imidazolium compound IBN-65 (1-benzyl-2-phenyl-3-(4-isopropyl)-benzyl-imidazolium
Yong Bian et al.
Biochemical and biophysical research communications, 463(4), 612-617 (2015-06-06)
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates
Chuen-Mao Yang et al.
Journal of cellular physiology, 230(10), 2351-2361 (2015-04-30)
Carbon monoxide (CO), a reaction product of the cytoprotective heme oxygenase (HO)-1, displays an anti-inflammatory effect in various cellular injuries, but the precise mechanisms of HO-1 expression remain unknown. We used the transition metal carbonyl compound carbon monoxide-releasing molecule-2 (CORM-2)
Philippe Dje N'Guessan et al.
Biochemical and biophysical research communications, 450(2), 1038-1044 (2014-07-01)
Chronic lower airway inflammation is considered to be a major cause of pathogenesis and disease progression in chronic obstructive pulmonary disease (COPD). Moraxella catarrhalis is a COPD-associated pathogen causing exacerbations and bacterial colonization in the lower airways of patients, which
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.