Skip to Content
MilliporeSigma

EZBRAIN42

Millipore

Human Amyloid β42 ELISA Kit

measures and quantifies Amyloid β42 levels in 50 μL tissue or cell lysates

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12161503
eCl@ss:
32161000
NACRES:
NA.77

Pricing and availability is not currently available.

Product Name

Human Amyloid β42 Brain ELISA, This Human Amyloid β42 Brain ELISA is used to measure & quantify Amyloid β42 levels in Neuroscience research.

Quality Level

species reactivity

human

packaging

kit of 1 × 96 wells

parameter

50 μL sample volume (Overnight assay)

assay range

sensitivity: 8 pg/mL
(lowest level of Amyloid β1-42 standard; 50 μL sample size)

standard curve range: 16-500 pg/mL

technique(s)

ELISA: suitable

input

sample type tissue/cellular lysate

application(s)

research use

detection method

colorimetric (450nm/590nm)

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU000301EMU006121EMU006851
Ensembl | mouse accession no.

ENSMUSG00000028890

Ensembl | mouse accession no.

ENSMUSG00000031337

Ensembl | mouse accession no.

ENSMUSG00000042340

Ensembl | mouse accession no.

ENSMUSG00000064068

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

esiRNA cDNA target sequence

CAGGTTTGTGGATGACAACGGACTGGTGCCTTCCTCATCTGGAACTGTTTATGATAGGACCACTGTTCTCATAGAACAGGACCCTGGCACTTTGGAGGATGATGAAGACGATGGACAGTGTGGAGAACCCTTGCCTTTTCTGGTGGAAGGTGAAGAGGGCTTCTTAATAGATCAGGAAGCAATGTCCCAGGGTTACGTACAACACATTATCTCACCAGATCAGATTCATTTGACTATAAACCCTGGTTCCGCACCCATGCCAAGAAACATTGAAGGTGCAACTCTTACTCTGCAGTCGGAATGTCCAGAAACGAAACGGAAAGAAGTAAAGCGGTACCAGTGCACCTTTGAGGGATGCCCTCGCACCTACAGCACAGCAGGCAACCTGCGCACCCACCAGAAGACTCACCGAGGAG

esiRNA cDNA target sequence

GGATCCAGGATTGGAAAGGTTCCAGGATGGCTTCTGCATCAGCATCTAAGTATAATTCACACTCCTTGGAGAATGAATCCATTAAGAAAGTGTCTCAAGATGGAGTCAGTCAGGATGTGAGTGAGACTGTCCCTCGGCTCCCAGGGGAGTTACTAATTACTGAAAAAGAAGTTATTTACATATGTCCTTTCAATGGCCCCATTAAGGGAAGAGTTTACATCACAAATTATCGTCTTTATTTAAGAAGTTTGGAAACGGATTCTGCTCTAATACTTGATGTTCCTCTGGGTGTGATATCAAGAATTGAATATATGGGAGGCGCGACTAGTAGAGGAGAAAATTCCTATGGTCTAGATATTACTTGTAAAGATTTGAGAAACCTGAGGTTTGCATTGAAGCA

esiRNA cDNA target sequence

CACTGCAGGCATCTTCTCAGCCAAGGTGCTGGGGTTCCACGTGTGCGGCCTCTATGGCGAGTGGGTGAGCCGCACAGAGGGCGACCTGGGCCAGCTGGTGCCAGGGGGCGTCGCCTGAGAGTGAATACTTTTTCTTGTAAGCTCGCTCTGTCTCGCCTCTTTGGCTTCAAATTTTCTGTCTCTCCATCTGTGTCCTGTGTGTTCTTGGGCTGTCCCTATCTTTCTGCATTTGTGTGGTCTCTCTCTTCTGCTCTCCTCTCTGCAGGGAGCTTCTTTTTTCCAACAGTTTCTCGTTTTGTCTCTCTCCAGTCTTGAACACTTTTGTCTCCGAGAGGTCTCTTTTTGTTTCCTTGTCTCTTGGTTCTTTCTTTGCTTGCTTGCTTGCTTGCTTGCTTGTTGTTGAGACAGGG

esiRNA cDNA target sequence

ACAAGACCAGCAATCCTTGGCAGAGCCCTTCAGGAACTCTGCCTGCTCTTCGAACCAGTGATGGGAAAGTCATTACAGTGCCAGACAAGATCATCACCCATCTTCGTAAAGAGAAGTATAATGCCGACTACGATCTGTCAGCTCGCCAAGGAGCAGATACCCTAGCCTTCATGTCTCTGCTGGAGGAGAAACTACTGCCTGTGCTAATCCATACTTTTTGGATAGACGCCAAGAACTATGTGGAAGTGACCCGAAAGTGGTATGCAGAGGCTATGCCCTTTCCCCTCAACTTCTTCCTGCCCGGCCGCATGCAGCGCCAGTACATGGAGCGGCTACAGCTGCTGTGTGGCGAGCACAAATCAGAGAACGAGGAGGAACTAGAAAAAGAGCTATACCAAGAGGCTCGGGAGT

Gene Information

mouse ... MTF1(17764), Mtf1(17764)

Gene Information

mouse ... MTM1(17772), Mtm1(17772)

Gene Information

mouse ... CTF1(13019), Ctf1(13019)

Gene Information

mouse ... MTX1(17827), Mtx1(17827)

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

Amyloid beta peptides have been implicated in the etiology of Alzheimer’s disease. Amyloid beta 40 is the most prominent peptide and Amyloid beta 42 is the neurotoxic form. The Amyloid beta 42/40-ratio (AB ratio) has been reported as a better indicator of the Alzheimer pathology. Millipore’s Human Amyloid β42 Brain ELISA kit is used for the measurement of Amyloid beta 42 in brain samples and for other tissue samples in a 96-well format. This assay is for research use only and appropriate for the in vitro detection of human Amyloid β42 peptides in brain samples from e.g. Guinea pig, transgenic hAmyloid mice and cell extracts.

Specificity

The Amyloid β42 ELISA uses monoclonal anti-Aβ antibodies with high selectivity for human Aβ. The capture antibody recognizes the C-terminal end of Amyloid β1-42, which causes a high selectivity for Aβ42. The cross-reactivity of the used antibodies to other Amyloid peptides was tested by ELISA and BIACORE and shows no significant cross-reactivity to Aβ1-38, Aβ1-39, Aβ1-42, Aβ1-43 and Aβ1-44.

Application

Research Category
Neuroscience
Research Sub Category
Alzheimer′s Disease
This Human Amyloid β42 Brain ELISA is used to measure & quantify Amyloid β42 levels in Neuroscience research.
This assay requires 50 µl of sample and is an overnight assay.
Used to detect/quantify: Amyloid β42

Storage and Stability

Components in the kit can be stored up to 2 weeks at 2-8°C

Other Notes

Please contact Technical Service for linearity of dilution.

Disclaimer

For research use only. Not for use in diagnostic procedures.

pictograms

CorrosionExclamation mark

signalword

Warning

Hazard Classifications

Aquatic Chronic 3 - Met. Corr. 1 - Skin Sens. 1

Storage Class

8A - Combustible corrosive hazardous materials


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jesse E Hanson et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(24), 8277-8288 (2014-06-13)
Extensive evidence implicates GluN2B-containing NMDA receptors (GluN2B-NMDARs) in excitotoxic-insult-induced neurodegeneration and amyloid β (Aβ)-induced synaptic dysfunction. Therefore, inhibiting GluN2B-NMDARs would appear to be a potential therapeutic strategy to provide neuroprotection and improve cognitive function in Alzheimer's disease (AD). However, there
Michael B McFerrin et al.
Annals of clinical and translational neurology, 4(7), 466-477 (2017-07-12)
The highly conserved 14-3-3 proteins interact with key players involved in Parkinson's disease (PD) and other neurodegenerative disorders. We recently demonstrated that 14-3-3 phosphorylation is increased in PD models and that increased 14-3-3 phosphorylation reduces the neuroprotective effects of 14-3-3
Y Goll et al.
Neuro-degenerative diseases, 13(2-3), 58-60 (2013-11-07)
Most Alzheimer's disease (AD) cases arise sporadically and may involve innate immune activation of microglial expressed Toll-like receptors regulated through the myeloid differentiation protein 88 (MyD88) pathway. It was the aim of this study to test the innate immune involvement
André E S Simões et al.
BMC genomics, 14, 181-181 (2013-03-19)
Simultaneous isolation of nucleic acids and proteins from a single biological sample facilitates meaningful data interpretation and reduces time, cost and sampling errors. This is particularly relevant for rare human and animal specimens, often scarce, and/or irreplaceable. TRIzol(®) and TRIzol(®)LS
Cheril Tapia-Rojas et al.
Molecular neurodegeneration, 10, 62-62 (2015-11-23)
L-methionine, the principal sulfur-containing amino acid in proteins, plays critical roles in cell physiology as an antioxidant and in the breakdown of fats and heavy metals. Previous studies suggesting the use of L-methionine as a treatment for depression and other

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service