Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

MABN1794

Sigma-Aldrich

Anti-GnRH-R Antibody, clone F1G4

clone FIG4, from mouse

Synonym(s):

Gonadotropin-releasing hormone receptor, GnRH receptor, GnRH-R, Leutinizing hormone-releasing hormone receptor, Luteinizing-releasing hormone receptor

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352203
eCl@ss:
32160702
NACRES:
NA.41

Pricing and availability is not currently available.

biological source

mouse

Quality Level

antibody form

purified immunoglobulin

antibody product type

primary antibodies

clone

FIG4, monoclonal

species reactivity

human

technique(s)

ELISA: suitable
dot blot: suitable
flow cytometry: suitable
immunohistochemistry: suitable (paraffin)
western blot: suitable

isotype

IgG1λ

NCBI accession no.

UniProt accession no.

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU001631EMU008051EMU017491
Gene Information

mouse ... DDR1(12305), Ddr1(12305)

Gene Information

mouse ... CACYBP(12301), Cacybp(12301)

Gene Information

mouse ... DDX1(104721), Ddx1(104721)

Gene Information

mouse ... CTNNA1(12385), Ctnna1(12385)

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | mouse accession no.

ENSMUSG00000003534

Ensembl | mouse accession no.

ENSMUSG00000014226

Ensembl | mouse accession no.

ENSMUSG00000037149

Ensembl | mouse accession no.

ENSMUSG00000037815

esiRNA cDNA target sequence

TCTTCGGGTGGAGCTCTATGGCTGCCTCTGGCGGGATGGACTCCTGTCATATACAGCCCCCGTGGGGCAGACCATGCAGTTATCTGAGGTGATGGTACATCTCAATGATTCCACTTACGATGGATATACTGCTGGAGGGCTGCAGTATGGCGGTCTGGGCCAGCTGGCAGATGGCGTGGTGGGCCTGGATGATTTCAGGCAGAGCCAGGAGCTGCGGGTCTGGCCAGGCTATGACTATGTGGGATGGAGCAATCAGAGCTTCCCCACGGGCTACGTGGAGATGGAGTTTGAGTTTGATCGGTTGAGGACCTTCCAGACCATGCAGGTCCACTGTAACAACATGCACACTCTGGGAGCCCGCCTACCAGGTGGGGTGGAATGCCGGTTTAAAAGGGGTCCCGCCATGGCCTGGGAAGGAGAGCCTGTCCGCCATGCTCTGGGAGGCAGCCTTGGAGACCCCAGAGCCCGGGCCATCTCAGTGCCCCTGGGTGGCCACGTGGGCCGCTTTCTGCAGTGCAGATTCCTCTTTGCAGGTCCTTGGTTACTCTTCAGTGAGATCTCTTTCATCTCAGATGTGGTGAACGACTCCTCTG

esiRNA cDNA target sequence

CGATGATATGAAGCGAACCATTAATAAAGCGTGGGTGGAATCCAGAGAGAAGCAAGCCAGAGAAGACACGGAATTTTGAGGCTTTTAAAAGTCCGTATGGGAACTGTGATGTGGAATGCTCGTGTTCCAGTAAGGGGATGTTGTTGAACTGCACATATTTGTTCATGTGGGTATGTAGTTTTGACAGATAAATATTTACACCGCCTTTTAAGTAAAGATAGCAGATTCTCCATTTCTTACTGGAGGATTTGATTTAAATAAATAAGCTTATTAAACTGTTTCCTTCATTAGCACCCCAGACATTTCGTTTCAGAAAAGGCTATATGGCACTCTTACTGAAAATGTAAAAAGGAAGTCTTGCATAATGAAAATGTTATGTCACAGACTTTTGTTCTGGCTGGGA

esiRNA cDNA target sequence

GATCCTAGGAGGAGGGGATGTACTCATGGCTGCAGAAACAGGAAGTGGAAAAACTGGTGCATTTAGTATTCCCGTTATCCAGATAGTGTATGAAACTCTGAAAGACCAACAGGAAGGAAAGAAAGGGAAAACAACTATTAAAACTGGTGCTTCAGTGCTCAACAAGTGGCAGATGAACCCATATGATAGAGGGTCTGCTTTTGCAATTGGATCAGATGGTCTGTGTTGTCAGAGCAGAGAAGTGAAGGAGTGGCATGGATGCAGAGGAACTAGAGGACTGCTGAAAGGGAAGCACTACTATGAGGTGTCCTGTCATGACCAAGGGCTATGCAGAGTTGGGTGGTCTACCATGCAGGCTTCCTTAGACCTAGGTACTGACAAGTTTGGATTTGGCTTCGGTGGAACAGGAAAGA

esiRNA cDNA target sequence

TTTCCTGGAGACCAATGTCCCTCTATTAGTACTGATTGAAGCTGCAAAGAATGGAAATGAGAAAGAAGTTAAGGAATATGCCCAAGTTTTTCGTGAACATGCCAACAAACTGATTGAGGTTGCCAACCTGGCCTGTTCAATCTCCAACAATGAAGAAGGCGTGAAGCTTGTCCGAATGTCTGCAAGCCAGTTAGAAGCGCTGTGTCCTCAGGTTATCAATGCTGCATTGGCGTTGGCAGCAAAGCCGCAGAGTAAACTGGCCCAAGAGAACATGGATCTTTTTAAAGAGCAATGGGAAAAGCAAGTCCGTGTTCTCACAGATGCTGTTGATGACATTACTTCCATCGATGACTTCTTGGCTGTCTCAGAGAACCACATTTTAGAAGATGTGAACAAGTGTGTTATTGCTCTCCAAGAGAAAGACGTGGATGGG

NCBI accession no.

NP_031610

NCBI accession no.

NM_009786

NCBI accession no.

NM_134040

NCBI accession no.

NM_009818

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

Gonadotropin-releasing hormone receptor (UniProt P30968; also known as GnRH receptor, GnRH-R, Leutinizing hormone-releasing hormone receptor, Luteinizing-releasing hormone receptor) is encoded by the GNRHR (also known as GNRHR1, GRHR, LHRHR, LRHR) gene (Gene ID 2798) in human. GnRH-R belongs to the family of seven-transmembrane G-protein coupled receptors (GPCRs). GnRH-R resides primarily in the pituitary and is responsible for eliciting the actions of GnRH (also known as Luteinizing hormone-releasing hormone or LHRH) after its release from the hypothalamus. Luteinizing hormone (LH) is then secreted from gonadotropes of the anterior pituitary into the bloodstream following pulsatile stimulation of GnRH-R by GnRH/LHRH. The canonical GnRH-R designated by UniProt (P30968-1) corresponds to a 328-amino acid sequence that includes 4 extracellular domains (a.a. 1-38, 98-115, 185-212, 233-281), 7 transmembrane segments (a.a. 39-58, 78-97, 116-137, 165-184, 213-232, 282-300, 307-326), 4 intracellular domains (a.a. 59-77, 138-164, 233-281, 327-328). Multiple GnRH-R variants and post-translationally processed forms are reported in human brain samples.

Specificity

Specificity of clone F1G4 was demonstrated by tissue-specific staining and by immunogen peptide blocking (Karande, A.A., et al. (1995). Mol. Cell. Endocrinol. 114(102):51-56).

Immunogen

BSA-conjugated linear peptide corresponding to the N-terminal sequence of human GnRH-R.
Epitope: N-terminal extracellular domain.

Application

Detect GnRH-R using this Anti-GnRH-R Antibody, clone F1G4 validated for use in Western Blotting, Dot Blot, ELISA, Flow Cytometry, Immunohistochemistry (Paraffin).
Dot Blot Analysis: A representative lot detected the immunogen peptide by dot blot (Karande, A.A., et al. (1995). Mol. Cell. Endocrinol. 114(102):51-56).
ELISA Analysis: A representative lot detected the immobilized immunogen peptide by ELISA (Karande, A.A., et al. (1995). Mol. Cell. Endocrinol. 114(102):51-56).
Flow Cytometry Analysis: A representative lot detected surface GnRH-R immunoreactivity on live human breast carcinoma T47D and ovarian carcinoma OVCAR-3 cells. Most likely due to low affinity antibody binding or unoptimized antibody concentration used, only ~50% of the T47D and ~10% of the OVCAR-3 populations were stained (Karande, A.A., et al. (1995). Mol. Cell. Endocrinol. 114(102):51-56).
Immunohistochemistry Analysis: A rerepsentative lot detected GnRH-R expression on gonadotropin-producing endocrine cells (gonadotropes) in pituitary, as well as among neurons in human hippocampus and neocortex, using formalin-fixed, paraffin-embedded human tissue sections (Wilson, A.C., et al. (2006). J. Endocrinol. 191(3):651–663).
Immunohistochemistry Analysis: A rerepsentative lot detected similar hippocampus GnRH-R immunoreactivity among Alzheimer′s diseased (AD) and age-matched control brain sections, while significanly decreased GnRH-R immunoreactivity associated with the apical dendrites of pyramidal neurons was seen in the AD brain using formalin-fixed, paraffin-embedded tissue sections (Wilson, A.C., et al. (2006). J. Endocrinol. 191(3):651–663).
Immunohistochemistry Analysis: A rerepsentative lot detected GnRH-R-positive cells in the anterior pituitary, but not the posterior pituitary using frozen human brain sections. Pre-blocking with immunogen peptide abolished the antibody staining (Karande, A.A., et al. (1995). Mol. Cell. Endocrinol. 114(102):51-56).
Western Blotting Analysis: A rerepsentative lot detected the expression of multiple GnRH-R variants in human cortex and pituitary tissue lysates, including the most prominent 30 kDa, 64 kDa, and 136 kDa bands. The 136 kDa band was seen significantly downregulated in the cortex, but not pituitary from Alzheimer′s diseased (AD) brain when compared to age-matched control (Wilson, A.C., et al. (2006). J. Endocrinol. 191(3):651–663).
Research Category
Neuroscience
Research Sub Category
Hormones & Receptors

Quality

Evaluated by Western Blotting in human pituitary tissue lysate.

Western Blotting Analysis: 2.0 µg/mL of this antibody detected GnRH-R in 10 µg of human pituitary tissue lysate.

Target description

~34 kDa observed. Clone F1G4 was reported to detect multiple GnRH-R variants and posttranslationally processed forms in human brain samples (Wilson, A.C., et al. (2006). J. Endocrinol. 191(3):651–663).

Physical form

Format: Purified
Protein G Purified
Purified mouse monoclonal IgG1λ antibody in buffer containing 0.1 M Tris-Glycine (pH 7.4), 150 mM NaCl with 0.05% sodium azide.

Storage and Stability

Stable for 1 year at 2-8°C from date of receipt.

Other Notes

Concentration: Please refer to lot specific datasheet.

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

12 - Non Combustible Liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


  • Certificates of Analysis (COA)

    Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

    Already Own This Product?

    Find documentation for the products that you have recently purchased in the Document Library.

    Visit the Document Library

    Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

    Contact Technical Service