Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

AV38984

Sigma-Aldrich

Anti-MAFF antibody produced in rabbit

IgG fraction of antiserum

Synonym(s):

Anti-v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352203
NACRES:
NA.41

biological source

rabbit

Quality Level

conjugate

unconjugated

antibody form

IgG fraction of antiserum

antibody product type

primary antibodies

clone

polyclonal

form

buffered aqueous solution

mol wt

18 kDa

species reactivity

mouse, human, dog, bovine, horse, rat, guinea pig, rabbit

concentration

0.5 mg - 1 mg/mL

technique(s)

western blot: suitable

NCBI accession no.

UniProt accession no.

shipped in

wet ice

storage temp.

−20°C

Gene Information

human ... MAFF(23764)

Immunogen

Synthetic peptide directed towards the N terminal region of human MAFF

Biochem/physiol Actions

MAFF is a basic leucine zipper transcription factor that binds to the promoter of oxytocin receptor gene. It lacks a transactivation domain but forms a homodimer that can repress transcription. MAFF reportedly regulates the gene expression in response to proinflammatory cytokines in myometrial cells.

Sequence

Synthetic peptide located within the following region: SVRELNRHLRGLSAEEVTRLKQRRRTLKNRGYAASCRVKRVCQKEELQKQ

Physical form

Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose.

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

T Kimura et al.
Biochemical and biophysical research communications, 264(1), 86-92 (1999-10-21)
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term
Wael Massrieh et al.
Biology of reproduction, 74(4), 699-705 (2005-12-24)
The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine
Daniel N Itzhak et al.
Disease models & mechanisms, 12(11) (2019-10-20)
The unfolded protein response (UPR) involves extensive proteome remodeling in many cellular compartments. To date, a comprehensive analysis of the UPR has not been possible because of technological limitations. Here, we employ stable isotope labeling with amino acids in cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service