Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTGAGGGCACAGAAATGTTTGAGGTCTATGGGACGCCTGGCGTGGACATCTACATCTCTCCCAACATGGAGAGGGGCCGGGAGCGTGCAGACACCAGGCGGTGGCGCTTTGACGCGACTTTGGAGATCATCGTGGTCATGAACTCCCCCAGCAATGACCTCAACGACAGCCATGTTCAGATTTCCTACCACTCCAGCCATGAGCCTCTGCCCCTGGCCTATGCGGTGCTCTACCTCACCTGTGTTGACATCTCTCTGGATTGCGACCTGAACTGTGAGGGAAGGCAGGACAGGAACTTTGTAGACAAGCGGCAGTGGGTCTGGGGGCCCAGTGGGTATGGCGGCATCTTGCTGGTGAACTGTGACCGTGATGATCCGAGCTGTGATGTCCAGGACAATTGTGACCAGCACGTGCACTGCCTGCAAGACCTGGAAGACATGTCTGTCATGGTCCTGCGGACGCAGGGCCCTGCAGCCCTCTTTGATGACCACAAACTTGTCCTCCATACCTCCAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PADI3(51702), PADI3(51702)
1 of 4
This Item | 30273-U | 30244-U | 30276-U |
|---|---|---|---|
| material Tedlar® PVDF film | material Tedlar® PVDF film | material Tedlar® PVDF , Tedlar® PVDF film | material Tedlar® PVDF film |
| agency suitable for ASTM® D5504 (Sulfur Compounds in Natural Gas and Fuels by GC), suitable for EPA 40,TO-3,TO-15 (Volatile Organic Compounds (VOCs)), suitable for EPA TO-14A (Volatile Organic Compounds (VOCs) by GC/MS), suitable for EPA 18 (Gaseous Organic Compounds; VOCs by GC), suitable for NIOSH 3704 (Perchloroethylene), suitable for EPA TO-12 (Non-Methane Organic Compounds (NMOC)) | agency suitable for ASTM® D5504 (Sulfur Compounds in Natural Gas and Fuels by GC), suitable for EPA 18 (Gaseous Organic Compounds; VOCs by GC), suitable for EPA 40,TO-3,TO-15 (Volatile Organic Compounds (VOCs)), suitable for EPA TO-12 (Non-Methane Organic Compounds (NMOC)), suitable for EPA TO-14A (Volatile Organic Compounds (VOCs) by GC/MS), suitable for NIOSH 3704 (Perchloroethylene) | agency suitable for ASTM® D5504 (Sulfur Compounds in Natural Gas and Fuels by GC), suitable for EPA 18 (Gaseous Organic Compounds; VOCs by GC), suitable for EPA 40,TO-3,TO-15 (Volatile Organic Compounds (VOCs)), suitable for EPA TO-12 (Non-Methane Organic Compounds (NMOC)), suitable for EPA TO-14A (Volatile Organic Compounds (VOCs) by GC/MS), suitable for NIOSH 3704 (Perchloroethylene) | agency suitable for ASTM® D5504 (Sulfur Compounds in Natural Gas and Fuels by GC), suitable for EPA 18 (Gaseous Organic Compounds; VOCs by GC), suitable for EPA 40,TO-3,TO-15 (Volatile Organic Compounds (VOCs)), suitable for EPA TO-12 (Non-Methane Organic Compounds (NMOC)), suitable for EPA TO-14A (Volatile Organic Compounds (VOCs) by GC/MS), suitable for NIOSH 3704 (Perchloroethylene) |
| technique(s) whole air sampling: suitable | technique(s) whole air sampling: suitable | technique(s) whole air sampling: suitable | technique(s) whole air sampling: suitable |
| description Screw Cap Valve (SCV) | description Screw Cap Valve (SCV), septum type: yes; Thermogreen® LB-2 | description SCV (Screw Cap Valve), septum type: yes; Thermogreen® LB-2 | description Screw Cap Valve (SCV), septum type: yes; Thermogreen® LB-2 |
| packaging pkg of 10 bags | packaging pkg of 10 bags | packaging pkg of 5 ea | packaging pkg of 10 bags |
| W × L 12 in. × 14 in. | W × L - | W × L - | W × L - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
