All Photos(1)

Key Documents

View All Documentation

EHU016511

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CHN1

Sign Into View Organizational & Contract Pricing

All Photos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

Pricing and availability is not currently available.

description

Quality Level

100

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCAT

Ensembl | human accession no.

ENSG00000128656

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHN1(1123), CHN1(1123)

Related Categories

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item	SML3043	SML3526	SML3641
SML3619 Linagliptin	SML3043 XL188	SML3526 AZD8529	SML3641 Volasertib
assay ≥98% (HPLC)	assay ≥98% (HPLC)	assay ≥98% (HPLC)	assay ≥95% (HPLC)
form powder	form powder	form powder	form powder
Quality Level 100	Quality Level 100	Quality Level 100	Quality Level 100
storage temp. -10 to -25°C	storage temp. 2-8°C	storage temp. 2-8°C	storage temp. -10 to -25°C
solubility DMSO: 2 mg/mL, clear (Warmed)	solubility DMSO: 2 mg/mL, clear	solubility DMSO: 2 mg/mL, clear	solubility DMSO: 2 mg/mL, clear (Warmed)
color white to beige	color white to beige	color white to beige	color white to beige

General description

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

UAS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Adenoma of the human pituitary producing growth hormone and thyrotropin. A histologic, immunocytologic and fine-structural study.

K Kovacs et al.

Virchows Archiv. A, Pathological anatomy and histology, 395(1), 59-68 (1982-01-01)

A pituitary adenoma removed by surgery from a 22-year-old man was studied by histology, immunocytology, transmission electron microscopy and immunoelectron microscopy. Clinically, the patient had acromegaly and euthyroidism with elevated blood GH concentrations. Blood TSH and T4 levels were within

Histopathological analyses of silent pituitary somatotroph adenomas using immunohistochemistry, in situ hybridization and confocal laser scanning microscopic observation.

A Matsuno et al.

Pathology, research and practice, 197(1), 13-20 (2001-02-24)

To characterize the morphological and functional aspects of silent somatotroph adenomas with paradoxical responses of GH in TRH or GnRH provocation tests, which are considered to be a useful strategy for endocrinological identification of silent somatotroph adenomas, we examined three

Co-expression of GH and GHR isoforms in prostate cancer cell lines.

L K Chopin et al.

Growth hormone & IGF research : official journal of the Growth Hormone Research Society and the International IGF Research Society, 12(2), 126-136 (2002-08-15)

Prostate cancer is a significant cause of morbidity and mortality in Western males. While it is known that androgens play a central role in prostate cancer development and progression, other hormones and growth factors are also involved in prostate growth.

Morphofunctional study of pituitary adenomas with acromegaly by immunoperoxidase technique and electron microscopy.

T Fukaya et al.

Cancer, 45(7), 1598-1603 (1980-04-01)

In attempting to establish a functional classification of acidophilic adenomas of the pituitary gland, immunoperoxidase staining techniques specific for growth hormone (GH), prolactin (PRL), and luteinizing hormone (LH) were carried out. Surgically removed specimens from 24 acromegalic patients were studied.

Increased expression of growth hormone and prolactin receptors in hepatocellular carcinomas.

T García-Caballero et al.

Endocrine, 12(3), 265-271 (2000-08-30)

The liver is an essential target tissue for growth hormone (GH) and prolactin (PRL). The aim of this study was to determine the in situ expression of growth hormone receptor (GHR) and prolactin receptor (PRLR) in hepatocellular carcinomas and to

View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service