Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU035901

Sigma-Aldrich

MISSION® esiRNA

targeting human AP2M1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAGGCACAGCTGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACTGCACCTTCCACCAGTGTGTGCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTTATCCCGCCAGATGGAGAGTTTGAGCTTATGAGGTATCGCACAACCAAGGACATCATCCTTCCCTTCCGGGTGATCCCGCTAGTGCGAGAAGTGGGACGCACCAAACTGGAGGTCAAGGTGGTCATCAAGTCCAACTTTAAACCCTCACTGCTGGCTCAGAAGATCGAGGTGAGGATCCCAACCCCACTGAACACAAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCCAAGTACAAGGCCAGCGAGAATGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCGCAGATCAGCGCAGAGATTGAGCTTCTGCCTACCAACGACAAGAAGAAATGGGCTCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Frederic Daste et al.
The Journal of cell biology, 216(11), 3745-3765 (2017-09-20)
The conditional use of actin during clathrin-mediated endocytosis in mammalian cells suggests that the cell controls whether and how actin is used. Using a combination of biochemical reconstitution and mammalian cell culture, we elucidate a mechanism by which the coincidence
Shuofeng Yuan et al.
Science advances, 6(35), eaba7910-eaba7910 (2020-09-15)
Targeting a universal host protein exploited by most viruses would be a game-changing strategy that offers broad-spectrum solution and rapid pandemic control including the current COVID-19. Here, we found a common YxxØ-motif of multiple viruses that exploits host AP2M1 for
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service