Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU037081

Sigma-Aldrich

MISSION® esiRNA

targeting human HAVCR2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAGATCCAACCACCTTATTTTTGAGCTTGGTGTTTTGTCTTTTTCAGAAACTATGAGCTGTGTCACCTGACTGGTTTTGGAGGTTCTGTCCACTGCTATGGAGCAGAGTTTTCCCATTTTCAGAAGATAATGACTCACATGGGAATTGAACTGGGACCTGCACTGAACTTAAACAGGCATGTCATTGCCTCTGTATTTAAGCCAACAGAGTTACCCAACCCAGAGACTGTTAATCATGGATGTTAGAGCTCAAACGGGCTTTTATATACACTAGGAATTCTTGACGTGGGGTCTCTGGAGCTCCAGGAAATTCGGGCACATCATA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cecilia Fernandez-Ponce et al.
PloS one, 9(1), e85191-e85191 (2014-01-28)
Adaptive T cell responses are critical for controlling HCV infection. While there is clinical evidence of a relevant role for regulatory T cells in chronic HCV-infected patients, based on their increased number and function; mechanisms underlying such a phenomena are
Huapeng Lin et al.
Oncology letters, 14(5), 5899-5905 (2017-11-09)
T-cell immunoglobulin mucin (TIM)-3 is an important member of the TIM gene family, which was thought to contribute to the progression of numerous types of cancer, including hepatocellular carcinoma (HCC); however, the mechanism underlying TIM-3 functions in HCC progression has
Rong-Ti Ge et al.
Immunologic research, 64(2), 470-475 (2015-09-26)
The T helper 1 (Th1) polarization plays a critical role in the pathogenesis of a number of inflammatory disorders in the body; the remedies in the correction of polarized Th1 cells are limited. This study aims to investigate the role
Yong-Rui Piao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(11), 11409-11414 (2014-08-15)
T cell immunoglobulin domain and mucin domain-containing molecule 3 (Tim-3) is a newly discovered immunomodulatory, which plays an important role in immunity regulation. Recent evidence suggests that Tim-3 is differentially regulated in a variety of tumors and has a potential
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service