description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAGCCAAACTCTCTGAACTCATCCAGCCCCTTCCCCTGGAGAGGGACTGCTCAGCCAACACCACCAGCTGCCACATCCTGGGCTGGGGCAAGACAGCAGATGGTGATTTCCCTGACACCATCCAGTGTGCATACATCCACCTGGTGTCCCGTGAGGAGTGTGAGCATGCCTACCCTGGCCAGATCACCCAGAACATGTTGTGTGCTGGGGATGAGAAGTACGGGAAGGATTCCTGCCAGGGTGATTCTGGGGGTCCGCTGGTATGTGGAGACCACCTCCGAGGCCTTGTGTCATGGGGTAACATCCCCTGTGGATCAAAGGAGAAGCCAGGAGTCTACACCAACGTCTGCAGATACACGAACTGGATCCAAAAAACCATTCAGGCCAAGTGACCCTGACATGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KLK6(5653), KLK6(5653)
1 of 4
This Item | F0805 | SAB4200576 | HPA069613 |
|---|---|---|---|
| Gene Information human ... LOXL2(4017) | Gene Information mouse ... Foxl2(26927) | Gene Information human ... COX2(5743) | Gene Information human ... FOXL2(668) |
| species reactivity mouse, rat, human | species reactivity mouse, hamster | species reactivity human, mouse | species reactivity human |
| biological source rabbit | biological source rabbit | biological source rabbit | biological source rabbit |
| clone monoclonal | clone polyclonal | clone polyclonal | clone polyclonal |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| shipped in wet ice | shipped in dry ice | shipped in dry ice | shipped in wet ice |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
