Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU060341

Sigma-Aldrich

MISSION® esiRNA

targeting human TBXAS1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGACATCCCAAGCCTTCTCCTTTCATTGGAAACTTGACATTTTTCCGCCAGGGTTTTTGGGAAAGCCAAATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGTCGTCGGATGTTTATTGTTATTTCTGAGCCAGACATGATCAAGCAGGTGTTGGTTGAGAACTTCAGTAACTTTACCAACAGAATGGCGTCGGGTTTGGAGTTCAAGTCGGTAGCCGACAGCGTTCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAGGTGCCCTGATGTCTGCTTTCAGTCCTGAAAAGCTGAACGAGATGGTTCCCCTCATCAGCCAAGCCTGCGAACTTCTCCTGGCTCATTTAAAACGCTATGCGGAATCTGGGGACGCATTTGACATCCAGAGGTGCTACTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hyun Su Lee et al.
Molecular medicine reports, 12(3), 4782-4788 (2015-06-24)
5‑Fluorouracil (5‑FU), one of the oldest anticancer therapeutic agents, is increasingly being administered in cancer chemotherapy. In the present study, the anticancer effects of 5‑FU combined with corosolic acid (CRA) were determined in SNU‑620 human gastric carcinoma cells and the
Chaitali N Mahajan et al.
Pediatric research, 77(3), 455-462 (2014-12-19)
Persistent pulmonary hypertension of the newborn (PPHN) is associated with decreased lung angiogenesis and impaired pulmonary vasodilatation at birth. Prostanoids are important modulators of vascular tone and angiogenesis. We hypothesized that altered levels of prostacyclin (PGI₂), a potent vasodilator, and
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
P Svenningsen et al.
Acta physiologica (Oxford, England), 212(2), 166-174 (2014-06-11)
In the renal collecting ducts, ATP stimulates a Ca(2+) -activated chloride current. The identity of the channel responsible for the current under physiological conditions is not known and it was hypothesized that TMEM16a is a relevant candidate in the renal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service