description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGACCCCAAGGACTTGAAAAAACTGCTCAGAACCCGGAATAATGTACTGGTGCTTTACTCCAAATCTGAGGTGGCAGCTGAAAATCATCTCAGGTTACTGTCCACAGTGGCCCAGGCGGTGAAAGGACAAGGGACCATCTGCTGGGTGGACTGTGGTGATGCAGAGAGTAGAAAATTGTGCAAGAAGATGAAAGTTGACCTGAGCCCGAAGGACAAAAAGGTTGAATTATTCCATTACCAGGATGGTGCATTTCATACTGAATATAACCGAGCTGTGACATTTAAGTCCATAGTGGCCTTTTTGAAGGATCCAAAAGGGCCCCCACTGTGGGAGGAAGATCCTGGAGCCAAAGATGTTGTCCACCTTGACAGTGAAAAGGACTTCAGACGGCTCCTGAAGAAGGAAGAGAAGCCGCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PDIA5(10954), PDIA5(10954)
1 of 4
This Item | PHCC4 | PHCC360250 | PHCC340050 |
|---|---|---|---|
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
| manufacturer/tradename Scepter | manufacturer/tradename Scepter | manufacturer/tradename Scepter | manufacturer/tradename Scepter |
| parameter 10,000 particles/mL particle concentration (500,000 particles/mL) | parameter 50,000 particles/mL particle concentration (1,500,000 particles/mL) | parameter 10000 particles/mL particle concentration (500000 particles/mL) | parameter 50000 particles/mL particle concentration (1500000 particles/mL) |
| technique(s) cell counting: suitable | technique(s) cell counting: suitable | technique(s) cell counting: suitable | technique(s) cell counting: suitable |
| particle size 6–36 μm | particle size 3-18 μm | particle size 6-36 μm | particle size 4-18 μm |
| compatibility for use with cells sized 8.0–25.0 μm | compatibility for use with cells sized 4.0–12.0 μm | compatibility Scepter, for use with cells sized 8.0–25.0 μm | compatibility Scepter for use with cells sized 5.0–15.0 μm |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
