description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TNFRSF10B(8795), TNFRSF10B(8795)
1 of 4
This Item | HPA060372 | HPA041672 | HPA024214 |
|---|---|---|---|
| biological source rabbit | biological source rabbit | biological source rabbit | biological source rabbit |
| conjugate unconjugated | conjugate unconjugated | conjugate unconjugated | conjugate unconjugated |
| Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level 100 |
| antibody form affinity isolated antibody | antibody form affinity isolated antibody | antibody form affinity isolated antibody | antibody form affinity isolated antibody |
| product line Prestige Antibodies® Powered by Atlas Antibodies | product line Prestige Antibodies® Powered by Atlas Antibodies | product line Prestige Antibodies® Powered by Atlas Antibodies | product line Prestige Antibodies® Powered by Atlas Antibodies |
| technique(s) immunofluorescence: 0.25-2 μg/mL | technique(s) immunoblotting: 0.04-0.4 μg/mL, immunohistochemistry: 1:20-1:50 | technique(s) immunofluorescence: 0.25-2 μg/mL | technique(s) immunoblotting: 0.04-0.4 μg/mL, immunofluorescence: 0.25-2 μg/mL, immunohistochemistry: 1:50-1:200 |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Articles
Filtration is used in dissolution testing to end the dissolution process and prepare the sample for HPLC analysis. This page discusses the importance of filtration and utility of hydrophilic PTFE Millex® syringe filters in dissolution testing.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
