Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU081301

Sigma-Aldrich

MISSION® esiRNA

targeting human RACGAP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTCATTGTTGGGAGCTTTTAGATGAGACATCTTTCCAGGGGTAGAAGGGTTAGTATGGAATTGGTTGTGATTCTTTTTGGGGAAGGGGGTTATTGTTCCTTTGGCTTAAAGCCAAATGCTGCTCATAGAATGATCTTTCTCTAGTTTCATTTAGAACTGATTTCCGTGAGACAATGACAGAAACCCTACCTATCTGATAAGATTAGCTTGTCTCAGGGTGGGAAGTGGGAGGGCAGGGCAAAGAAAGGATTAGACCAGAGGATTTAGGATGCCTCCTTCTAAGAACCAGAAGTTCTCATTCCCCATTATGAACTGAGCTATAATATGGAGCTTTCATAAAAATGGGATGCATTGAGGACAGAACTAGTGATGGGAGTATGCGTAGCTTTGATTTGGATGATTAGGTCTTTAATAGTGTTGAGTGGCACAACCTTG

Ensembl | human accession no.

ENSG00000161800

NCBI accession no.

NM_013277

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RACGAP1(29127) , RACGAP1(29127)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xinchun Ding et al.
Oncotarget, 8(18), 30123-30137 (2017-04-19)
Lysosomal acid lipase (LAL) is a critical neutral lipid metabolic enzyme that regulates metabolic reprogramming in myeloid-derived suppressor cells (MDSCs) through over-activation of mammalian target of rapamycin (mTOR). Affymetrix GeneChip microarray analysis of MDSCs from LAL deficient mouse (lal-/-) revealed
Matthew L Kutys et al.
Nature cell biology, 16(9), 909-917 (2014-08-26)
Rho-family GTPases govern distinct types of cell migration on different extracellular matrix proteins in tissue culture or three-dimensional (3D) matrices. We searched for mechanisms selectively regulating 3D cell migration in different matrix environments and discovered a form of Cdc42-RhoA crosstalk
Arjan J van Adrichem et al.
FEBS letters, 589(24 Pt B), 3859-3865 (2015-11-26)
Male germ cell Rac GTPase-activating protein (MgcRacGAP) is a core regulator of cytokinesis. Furthermore, it appears to be involved in human oncogenesis through cytokinesis-independent mechanisms and has been reported to be essential for nuclear translocation of signal transducer and activator
Toshiyuki Kawashima et al.
The Journal of cell biology, 175(6), 937-946 (2006-12-21)
STAT transcription factors are tyrosine phosphorylated upon cytokine stimulation and enter the nucleus to activate target genes. We show that Rac1 and a GTPase-activating protein, MgcRacGAP, bind directly to p-STAT5A and are required to promote its nuclear translocation. Using permeabilized

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service