description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTCCAGAAGACCCAGCAGAGGCCCCTAGGACGCTCCTAGAATTTGAAACACAATCCATGGTACCGCCCACGGGGTTCTCAGAAGAGGAAGGTAAGGCATTGGAGGAAGAAGAGAAATATGAAGATGAAGAAGAGAAAGAGGAGGAAGAAGAAGAGGAGGAGGTGGAGGATGAGGCTCTGTGGGCATGGCCCAGCGAGCTCAGCAGCCCGGGCCCTGAGGCCTCTCTCCCCACTGAGCCAGCAGCCCAGGAGGAGTCACTCTCCCAGGCGCCAGCAAGGGCAGTCCTGCAGCCTGGTGCATCACCACTTCCTGATGGAGAGTCAGAAGCTTCCAGGCCTCCAAGGGTCCATGGACCACCTACTGAGACTCTGCCCACTCCCAGGGAGAGGAACCTAGCATCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BCAN(63827), BCAN(63827)
1 of 4
This Item | 03-0155-00 | 03-0123-00 | 03-0136-00 |
|---|---|---|---|
| technique(s) ELISA: suitable, single molecule counting: suitable | technique(s) ELISA: suitable, single molecule counting: suitable | technique(s) ELISA: suitable, single molecule counting: suitable | technique(s) ELISA: suitable, single molecule counting: suitable |
| description LLOQ range: 0.02-0.08 pg/mL, refer to CoA forlot-specific LLOQ | description - | description - | description - |
| species reactivity guinea pig, nonhuman primates, rat, canine | species reactivity human | species reactivity mouse | species reactivity mouse |
| manufacturer/tradename SMC® | manufacturer/tradename SMC® | manufacturer/tradename SMC® | manufacturer/tradename SMC® |
| assay range inter-assay cv: <20% | assay range - | assay range - | assay range - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
See how you can enhance your immunology research through the power of high sensitivity immunoassays by harnessing Single Molecule Counting (SMC®) technology to precisely characterize interferons, interleukins, and immunoglobins.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
