All Photos(1)

Key Documents

EHU091321

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human SPEF2 (1)

Sign Into View Organizational & Contract Pricing

All Photos(1)

About This Item

UNSPSC Code:

41105324

NACRES:

NA.51

Pricing and availability is not currently available.

description

Quality Level

100

product line

MISSION^®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGGCTGTTGGAACTCATGTCTTCCAACAAGTCAAAGCTTCCATTCCAAGTGCAGAAAAGACCTCCTCAACTGATGCAGGTCCAGCTGAGGAATTTCCTGAACCTGAGGAAAATGCTGCAAGAGAAGAAAGGAAATTAAAAGACGACACGGAGAAAAGGGAACAGAAGGATGAAGAAATCCCTGAAAATGCAAACAATGAAAAGATGTCCATGGAAACACTACTCAAAGTGTTCAAAGGGGGAAGTGAAGCACAGGACTCCAATAGATTTGCCAGCCACCTAAAGATAGAGAACATTTATGCAGAGGGCTTCATAAAAACATTTCAAGACCTAGGTGCCAAGAACCTGGAGCCAATTGAAGTCGCTGTTCTCTTGAAGCATCCTTTTATTCAAGACCT

Ensembl | human accession no.

ENSG00000152582

NCBI accession no.

NM_024867

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SPEF2(79925), SPEF2(79925)

Related Categories

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item	HPA062708	HPA043057	HPA024256
HPA045741 Anti-BPIFB3 antibody produced in rabbit	HPA062708 Anti-BPIFA3 antibody produced in rabbit	HPA043057 Anti-BPIFB6 antibody produced in rabbit	HPA024256 Anti-BPIFB1 antibody produced in rabbit
conjugate unconjugated	conjugate unconjugated	conjugate unconjugated	conjugate unconjugated
biological source rabbit	biological source rabbit	biological source rabbit	biological source rabbit
Quality Level 100	Quality Level 100	Quality Level 100	Quality Level 100
antibody form affinity isolated antibody	antibody form affinity isolated antibody	antibody form affinity isolated antibody	antibody form affinity isolated antibody
product line Prestige Antibodies^® Powered by Atlas Antibodies	product line Prestige Antibodies^® Powered by Atlas Antibodies	product line Prestige Antibodies^® Powered by Atlas Antibodies	product line Prestige Antibodies^® Powered by Atlas Antibodies
shipped in wet ice	shipped in wet ice	shipped in wet ice	shipped in wet ice

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Specification Sheet

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

DOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Medications to decrease the risk for breast cancer in women: recommendations from the U.S. Preventive Services Task Force recommendation statement.

Virginia A Moyer

Annals of internal medicine, 159(10), 698-708 (2013-09-26)

Update of the 2002 U.S. Preventive Services Task Force (USPSTF) recommendation on the use of medications for breast cancer risk reduction. The USPSTF reviewed evidence on the effectiveness,adverse effects, and subgroup variations of medications to reduce the risk for breast

Selective estrogen receptor modulation attenuates proteinuria-induced renal tubular damage by modulating mitochondrial oxidative status.

Yuko Nishi et al.

Kidney international, 83(4), 662-673 (2013-01-25)

Proteinuria is an independent risk factor for progressive renal diseases because it initiates or aggravates tubulointerstitial injury. Clinically, females are less susceptible to progression of chronic kidney disease; however, the mechanisms underlying the renoprotective effect of estrogen receptor stimulation have

Preparation and evaluation of raloxifene-loaded solid dispersion nanoparticle by spray-drying technique without an organic solvent.

Tuan Hiep Tran et al.

International journal of pharmaceutics, 443(1-2), 50-57 (2013-01-16)

The aim of this study was to improve the physicochemical properties and bioavailability of a poorly water-soluble drug, raloxifene by solid dispersion (SD) nanoparticles using the spray-drying technique. These spray-dried SD nanoparticles were prepared with raloxifene (RXF), polyvinylpyrrolidone (PVP) and

Two-phase designs to follow-up genome-wide association signals with DNA resequencing studies.

Daniel J Schaid et al.

Genetic epidemiology, 37(3), 229-238 (2013-01-26)

Genome-wide association studies (GWAS) of complex traits have generated many association signals for single nucleotide polymorphisms (SNPs). To understand the underlying causal genetic variant(s), focused DNA resequencing of targeted genomic regions is commonly used, yet the current cost of resequencing

Potential of Raloxifene in reversing osteoarthritis-like alterations in rat chondrocytes: an in vitro model study.

Aysegul Kavas et al.

Journal of biosciences, 38(1), 135-147 (2013-02-07)

The aim of this study was to investigate the effects of Raloxifene (Ral) on degeneration-related changes in osteoarthritis (OA)-like chondrocytes using two- and three-dimensional models. Five-azacytidine (Aza-C) was used to induce OA-like alterations in rat articular chondrocytes and the model

View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service