description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATTCATTTTGGGGAACAGAAGATCCATAACTTTAGAAATACGGGTTTTGACTTAACTCACAAGAGAACTCATCATAAGTACTTGCTGATGGAAGAATGACCTAGTTGCTCCTCTCAACATGGGTACAGCAAACTCAGCACAGCCAAGAAGCCTCAGGTCGTGGAGAACATGGATTAGGATCCTAGACTGTAAAGACACAGAAGATGCTGACCTCACCCCTGCCACCTATCCCAAGACCTCACTGGTCTGTGGACAGCAGCAGAAATGTTTGCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MTOR(2475) , FRAP1(2475)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Clare F Malone et al.
Cancer discovery, 4(9), 1062-1073 (2014-06-11)
NF1 encodes a RAS GTPase-activating protein. Accordingly, aberrant RAS activation underlies the pathogenesis of NF1-mutant cancers. Nevertheless, it is unclear which RAS pathway components represent optimal therapeutic targets. Here, we identify mTORC1 as the key PI3K effector in NF1-mutant nervous
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service