description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAGTGACCAAAAACACCTTCAGGCAATACCGAGTCCTGGGCAAAGGTGGCTTTGGGGAGGTGTGCGCCTGCCAGGTGCGGGCCACAGGTAAGATGTATGCCTGCAAGAAGCTAGAGAAAAAGCGGATCAAGAAGCGGAAAGGGGAGGCCATGGCGCTGAACGAGAAGCAGATCCTGGAGAAAGTGAACAGTAGGTTTGTAGTGAGCTTGGCCTACGCCTATGAGACCAAGGACGCGCTGTGCCTGGTGCTGACACTGATGAACGGGGGCGACCTCAAGTTCCACATCTACCACATGGGCCAGGCTGGCTTCCCCGAAGCGCGGGCCGTCTTCTACGCCGCCGAGATCTGCTGTGGCCTGGAGGACCTGCACCGGGAGCGCATCGTGTACAGGGACCTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GRK6(2870), GRK6(2870)
1 of 4
This Item | SAB1400139 | WH0003569M1 | I7901 |
|---|---|---|---|
| conjugate unconjugated | conjugate unconjugated | conjugate unconjugated | conjugate unconjugated |
| Quality Level 200 | Quality Level 100 | Quality Level 100 | Quality Level 200 |
| biological source rabbit | biological source mouse | biological source mouse | biological source mouse |
| antibody form IgG fraction of antiserum | antibody form IgG fraction of antiserum | antibody form purified immunoglobulin | antibody form purified immunoglobulin |
| technique(s) neutralization: suitable using human IL-6 in a T1165 cell proliferation bioassay, radioimmunoassay: suitable | technique(s) immunofluorescence: suitable, western blot: 1 μg/mL | technique(s) indirect ELISA: suitable, western blot: 1-5 μg/mL | technique(s) indirect ELISA: suitable, neutralization: suitable, western blot: suitable |
| Gene Information human ... IL6(3569) | Gene Information human ... IL6(3569) | Gene Information human ... IL6(3569) | Gene Information human ... IL6(3569) |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
