Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGCAGCAGCAGTAGTAGCAGCAGCAGCAGTAGCAGCAGCAGCTGCGGCCCCCTCCCCGGGAAACCCGTGTACTCAACCCCGTCCCCAGTGGAAAACACCCCTCAGAATAATGAGTGCAAAATGGTGGATCTGAGGGGGGCCAAAGTGGCTTCCTTCACGGTGGAGGGCTGCGAGCTGATCTGCCTGCCCCAGGCTTTCGACCTGTTCCTGAAGCACTTGGTGGGGGGCTTGCATACGGTCTACACCAAGCTGAAGCGGCTGGAGATCACGCCGGTGGTGTGCAATGTGGAACAAGTTCGCATCCTGAGGGGACTGGGCGCCATCCAGCCAGGAGTGAACCGCTGCAAACTCATCTCCAGGAAGGACTTCGAGACCCTCTACAATGACTGCACCAACGCAAGTTCTA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DACH1(1602), DACH1(1602)
1 of 4
This Item | Z290610 | Z290459 | XX1014745 |
|---|---|---|---|
| manufacturer/tradename Sigma-Aldrich | manufacturer/tradename Sigma-Aldrich | manufacturer/tradename Sigma-Aldrich | manufacturer/tradename - |
| material borosilicate glass , glass housing | material borosilicate glass , glass housing | material borosilicate glass | material borosilicate glass |
| capacity 4000 mL | capacity 1000 mL | capacity 1000 mL | capacity - |
| packaging pack of 1, pkg of 1 ea | packaging pack of 1, pkg of 1 ea | packaging pack of 1, pkg of 1 ea | packaging - |
| sterility non-sterile | sterility non-sterile | sterility non-sterile | sterility - |
| bottle capacity 4000 mL | bottle capacity - | bottle capacity - | bottle capacity - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Customers Also Viewed
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
