description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTTCTTTGCTTGGCTCCATTTATGAAGCACCCGTTAAAAATAGTTCTACGAGGAGTGACCAATGATCAGGTTGACCCTTCAGTTGATGTTCTTAAGGCAACAGCACTCCCTTTGTTGAAACAATTTGGGATTGATGGTGAATCATTTGAACTGAAGATTGTGCGACGGGGAATGCCTCCCGGAGGAGGAGGCGAAGTGGTTTTCTCATGTCCTGTGAGGAAGGTCTTGAAGCCCATTCAACTCACAGATCCAGGAAAAATCAAACGTATTAGAGGAATGGCGTACTCTGTACGTGTGTCACCTCAGATGGCGAACCGGATTGTGGATTCTGCAAGGAGCATCCTCAACAAGTTCATACCTGATATCTATATTTACACAGATCACATGAAAGGAGTCAACTCTGGGAAGTCTCCGGGCTTTGGGTTGTCACTGGTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RCL1(10171), RCL1(10171)
Related Categories
1 of 4
This Item | T1948 | AV45673 | HPA003595 |
---|---|---|---|
conjugate unconjugated | conjugate unconjugated | conjugate unconjugated | conjugate unconjugated |
biological source mouse | biological source mouse | biological source rabbit | biological source rabbit |
Gene Information human ... ARG1(383) | Gene Information human ... TERF1(7013) | Gene Information human ... ARG1(383) | Gene Information human ... ARG1(383) |
species reactivity rat, human, mouse | species reactivity human | species reactivity dog, human | species reactivity human |
antibody form purified from hybridoma cell culture | antibody form purified from hybridoma cell culture | antibody form IgG fraction of antiserum | antibody form affinity isolated antibody |
clone ARG1-3, monoclonal | clone TRF-78, monoclonal | clone polyclonal | clone polyclonal |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service