description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAGAAGCCTGGAATTGTCTCGCCATTTAAACGAGTATTCCTAAAAGGTGAAAAGAGTAGAGATAAGAAAGCCCATGAGAAGGTGACAGAGAGGCGCCCTCTGCACACTGTGGTGTTGTCATTGCCTGAGCGCGTCGAGCCAGACAGACTGCTGAGCGACTATATTGAGAAGGAGGTAAAGTATTTAGGTCAGTTAACGTCCATACCAGGATACCTGAATCCCTCCAGTAGGACTGAAATCCTGCATTTCATAGACAATGCAAAGAGAGCCCACCAGCTTCCGGGACACTTGACTCAGGAGCACGATGCTGTGCTCAGCCTGTCTGCGTACAACGTCAAGCTGGCCTGGAGGGACGGGGAGGATATCATCCTCAGGGTGCCCATCCATGACATCGCCGCCGTCTCCTATGTTCGGGATGACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CCM2(83605), CCM2(83605)
Related Categories
1 of 4
This Item | CLS808015 | CLS806050 | CLS808050 |
---|---|---|---|
material borosilicate glass , conical bottom tube | material borosilicate glass , conical bottom tube | material borosilicate glass , conical bottom tube | material conical bottom tube |
manufacturer/tradename Corning 8060-15 | manufacturer/tradename Corning 8080-15 | manufacturer/tradename Corning 806050 | manufacturer/tradename Corning 8080-50 |
capacity 15 mL | capacity 15 mL | capacity 50.0 mL | capacity 50 mL |
packaging case of 12, pack of 2 | packaging case of 12, pack of 12 | packaging case of 12, pack of 2 | packaging case of 12, pack of 6 |
feature cap: no | feature cap: no | feature cap: no | feature - |
sterility non-sterile | sterility non-sterile | sterility non-sterile | sterility non-sterile |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service