description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
1 of 4
This Item | P3049 | P9560 | P2924 |
---|---|---|---|
manufacturer/tradename Finn 9401030 | manufacturer/tradename Finn 9400230 | manufacturer/tradename Finn 9401260 | manufacturer/tradename Finn 9402030 |
feature barrier: no | feature barrier: no | feature barrier: no | feature barrier: no |
sterility non-sterile | sterility non-sterile | sterility non-sterile | sterility non-sterile |
material blue | material colorless | material orange | material colorless |
packaging pack of 1000 ea (Bag) | packaging pack of 1000 ea (Bag) | packaging pack of 1000 ea (Bag) | packaging pack of 500 ea (Bag) |
maximum volume 1 mL | maximum volume 250 μL | maximum volume 300 μL | maximum volume 5 mL |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service