Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCGACAGCTCTCCAATACTCAGGTTAATGCTGAAAAATCATCCAAGACAGTTATTGCAAGAGTTTAATTTTTGAAAACTGGCTACTGCTCTGTGTTTACAGACGTGTGCAGTTGTAGGCATGTAGCTACAGGACATTTTTAAGGGCCCAGGATCGTTTTTTCCCAGGGCAAGCAGAAGAGAAAATGTTGTATATGTCTTTTACCCGGCACATTCCCCTTGCCTAAATACAAGGGCTGGAGTCTGCACGGGACCTATTAGAGTATTTTCCACAATGATGATGATTTCAGCAGGGATGACGTCATCATCACATTCAGGGCTATTTTTTCCCCCACAAACCCAAGGGCAGGGGCCACTCTTAGCTAAATCCCTCCCCGTGACTGCAATAGAACCCTCTGGGGAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DNMT3B(1789), DNMT3B(1789)
Related Categories
1 of 4
This Item | PHR2816 | PHR2711 | PHR3474 |
---|---|---|---|
application(s) pharmaceutical small molecule | application(s) pharmaceutical small molecule | application(s) pharmaceutical small molecule | application(s) pharmaceutical |
grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard |
agency traceable to Ph. Eur. B1045000, traceable to BP BP041, traceable to USP 1068004 | agency traceable to BP BP292, traceable to Ph. Eur. P2810000, traceable to USP 1557000 | agency traceable to USP 1285807 | agency traceable to USP 1069018 |
biological source synthetic | biological source - | biological source - | biological source - |
description Pharmaceutical Secondary Standard; Certified Reference Material | description Pharmaceutical Secondary Standard; Certified Reference Material | description Pharmaceutical Secondary Standard; Certified Reference Material | description - |
form solid | form solid | form solid | form - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service