Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU001801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tert

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGGTGAACTTCCCTGTGGAGCCTGGTACCCTGGGTGGTGCAGCTCCATACCAGCTGCCTGCTCACTGCCTGTTTCCCTGGTGTGGCTTGCTGCTGGACACTCAGACTTTGGAGGTGTTCTGTGACTACTCAGGTTATGCCCAGACCTCAATTAAGACGAGCCTCACCTTCCAGAGTGTCTTCAAAGCTGGGAAGACCATGCGGAACAAGCTCCTGTCGGTCTTGCGGTTGAAGTGTCACGGTCTATTTCTAGACTTGCAGGTGAACAGCCTCCAGACAGTCTGCATCAATATATACAAGATCTTCCTGCTTCAGGCCTACAGGTTCCATGCATGTGTGATTCAGCTTCCCTTTGACCAGCGTGTTAGGAAGAACCTCACATTCTTTCTGGGCATCATCTCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ki Chan Kim et al.
Molecular neurobiology, 53(10), 7312-7328 (2015-12-24)
In addition to its classical role as a regulator of telomere length, recent reports suggest that telomerase reverse transcriptase (TERT) plays a role in the transcriptional regulation of gene expression such as β-catenin-responsive pathways. Silencing or over-expression of TERT in
T Liu et al.
British journal of cancer, 108(11), 2272-2280 (2013-05-18)
Telomerase and telomerase reverse transcriptase (hTERT) confer cancer cells sustained proliferation and survival potentials. Targeting telomerase or hTERT is a novel anti-cancer strategy. However, telomerase/hTERT inhibition alone has minimal clinical efficacy. We explored the relationship between hTERT and cyclooxygenase 2
Xin Tian et al.
Evidence-based complementary and alternative medicine : eCAM, 2015, 546210-546210 (2016-01-20)
Bufalin, a digoxin-like active component of the traditional Chinese medicine Chan Su, exhibits potent antitumor activities in many human cancers. Bufalin induces mitochondria-dependent apoptosis in cancer cells, but the detailed molecular mechanisms are largely unknown. hTERT, the catalytic subunit of
Zhiping Liu et al.
PloS one, 8(1), e53576-e53576 (2013-01-18)
Our previous work had found that telomerase rejuvenated in the cytoplasm of corneal epithelial cells cultured in embryonic stem cell-conditioned medium, the functional properties of stem-like corneal epithelial cells can be enhanced by co-culturing with embryonic stem cells (ESCs) via
Lei Wang et al.
Journal of biomedical nanotechnology, 11(9), 1653-1661 (2015-10-22)
Current diagnostic techniques do not reliably detect cancer at early stages, and traditional chemotherapy lacks specificity and causes systemic toxicity. To address these issues, multifunctional nanomaterials are becoming more widely studied as a means of cancer detection, therapy, and monitoring.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service