Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU023881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Apex1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGACCAAGTGCTCGGAGAACAAACTCCCGGCTGAACTGCAAGAGCTGCCTGGACTCACCCATCAGTACTGGTCAGCTCCGTCAGACAAAGAAGGATACAGTGGTGTGGGCCTACTTTCCCGCCAGTGCCCGCTAAAAGTCTCTTATGGCATTGGCGAGGAAGAACATGATCAAGAAGGCCGGGTGATTGTGGCTGAATTTGAGTCCTTTGTCCTGGTAACAGCCTATGTTCCCAATGCAGGCAGGGGTCTGGTAAGACTGGAATACCGACAGCGTTGGGATGAAGCCTTCCGAAAGTTTCTAAAGGACTTGGCTTCCAGAAAGCCTCTAGTGCTATGTGGGGATCTCAATGTGGCTCATGAAGAAATTGACCTCCGTAACCCCAAAGGAAACAAAAAGAATGCTGGCTTTACTCCCCAGGAGCGCCAAGGTTTTGGGGAACTGCTACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhen Yang et al.
International journal of oncology, 45(5), 1820-1828 (2014-08-12)
Hepatocellular carcinoma (HCC) is responsible for a third of the estimated cancer-caused deaths worldwide. To deeply understand the mechanisms controlling HCC progression is of primary importance to develop new approaches for treatment. Apurinic/apyrimidinic endonuclease-1/redox effector factor 1 (APE/Ref-1) has been
Jiangdong Sui et al.
Drug design, development and therapy, 8, 2147-2160 (2014-11-15)
Apurinic/apyrimidinic endonuclease 1/redox factor-1 (APE1/Ref-1) is a multifunctional protein possessing both DNA repair and redox regulatory activities. It has been shown that blocking redox function leads to genotoxic, antiangiogenic, cytostatic, and proapoptotic effects in cells. Therefore, the selective inhibitors against
Ana P Montaldi et al.
Mutation research. Genetic toxicology and environmental mutagenesis, 793, 19-29 (2015-11-02)
Temozolomide (TMZ) is widely used for patients with glioblastoma (GBM); however, tumor cells frequently exhibit drug-resistance. Base excision repair (BER) has been identified as a possible mediator of TMZ resistance, and an attractive approach to sensitizing cells to chemotherapy. Human

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service