Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGAGACCTCTGGAACAGGCATTGGAGGACTGCCATGGTCACACAAAGAAACAGGTATGTGATGATATCAGCCGACGCTTGGCGCTGCTTCGAGAACAGTGGGCTGGAGGGAAGTTGTCAATACCTGTAAAGAAGAGGATGGCACTGCTAGTGCAAGAACTTTTACATCACCAGTGGGATGCAGCAGATGACATTCACCGATCACTCATGGTTGACCATGTGACTGAGGTCAGTCAGTGGATGGTGGGAGTAAAAAGATTAATTGCAGAAAAGAAGAGTCTATCTTCAGAGGAGACCAAAGAAGAGAAATTTACAGTGGAACCTGAGAACCAGACAATACCAGGCTTCCAACAGCCATCATAATGTCTGTGGCTCCCCAGACTCACTTCACCTGACTTCCTATGCCTTAGTGTGGAAGGCTTCTTCTTCCTTTTTACCACCAGGGAGACTATTGGTCTTGTGGGTCTTGACCAAAGATCCTATCTAGACCACTGCAAGATCACTTGTTATGTACATTTCAATAAACATCTCAATAAACATCTCAATGGTGGGAAGTGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SRA1(24068), Sra1(24068)
1 of 4
This Item | PHR2459 | PHR2231 | PHR2075 |
---|---|---|---|
application(s) pharmaceutical | application(s) pharmaceutical small molecule | application(s) pharmaceutical small molecule | application(s) pharmaceutical small molecule |
form powder | form solid | form powder | form - |
Quality Level 300 | Quality Level 300 | Quality Level 300 | Quality Level 300 |
grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard |
storage temp. 2-30°C | storage temp. 2-8°C | storage temp. -10 to -25°C | storage temp. 2-30°C |
packaging pkg of 1 g | packaging pkg of 50 mg | packaging pkg of 100 mg | packaging pkg of 50 mg |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Customers Also Viewed
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service