description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGCTGGACTGATATCCTGAACATCCTCTTGCAACATGGGGCTAATGTGAACTGCAGCTCGCAGGATGGCACAAGGCCAGTTCATGATGCTGTGGTCAATGACAACCTAGAAACCATCTGGCTCTTGCTATCCTACGGAGCTGATCCCACACTGGCTACCTACTCGGGTCAGACAGCCATGAAGCTGGCCAGCAGTGATAACATGAAGCGCTTTCTCAGTGATCACCTCTCGGATCTTCAGGGCAGGGCAGAGGGCGATCCCCGTGCGTCCTGGGATTTCTACAGCAGTTCTGTGTTGGAGAAAAAAGACGGGTTTGCCTGTGACCTCCTCCATAATCCTCCTGGGAGTGCCGAGCAAGGAGATGATTCAGAACAGGATGACTTCATGTTCGAACTCTCAGACAAGCCTCTCCTCCCTTGTTACAACCTCCAAGTGTCAGTGTCCCGTGGACCCTGCAACTGGTTCCTCTTCAGCGATGTCCT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... BCORL1(320376), Bcorl1(320376)
1 of 4
This Item | PHR3302 | PHR3174 | PHR1068 |
---|---|---|---|
agency traceable to Ph. Eur. A0365000, traceable to USP 1184005 | agency traceable to USP 1184027 | agency traceable to USP 1025351 | agency traceable to Ph. Eur. D2900000, traceable to USP 1233009 |
grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard | grade certified reference material, pharmaceutical secondary standard |
application(s) pharmaceutical | application(s) pharmaceutical | application(s) pharmaceutical | application(s) pharmaceutical (small molecule) |
packaging pkg of 200 mg | packaging pkg of 100 mg | packaging pkg of 500 mg | packaging - |
storage temp. 2-30°C | storage temp. 2-30°C | storage temp. 2-30°C | storage temp. 2-30°C |
Quality Level 300 | Quality Level 300 | Quality Level 300 | Quality Level 300 |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service