Recommended Products
description
targeting mouse LOC546967
form
lyophilized powder
esiRNA cDNA target sequence
CTTGGGCCAACTGACTAAGGAGGGGATCCGCCAGCAGCTAGAACTGGGCCGATTTCTGAGGAGGCGTTACAAGGCTTTCCTGAGCCCTGAGTACAAGCGAGAAGAGGTGTACATCCGCAGCACAGACTTTGACCGGACATTGGAGAGTGCACAAGCCAACCTGGCTGGGCTCTTCCCTGAGGCTGCCCCTGGAAGTCCTGAGACTGACTGGAAGCCCATTCCAGTGCACACAGTGCCTGTGTCTGAGGACAAGTTGCTGAGGTTCCCCATGCGCAGCTGTCCTCGATACCATGAGCTGTTACGAGAGTCCACAGAGG
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... LOC546967(100503991)
1 of 4
This Item | EMU219641 | EMU219651 | EMU219661 |
|---|---|---|---|
| Gene Information mouse ... LOC546967(100503991) | Gene Information mouse ... H1F0(14958) | Gene Information mouse ... HEBP1(15199) | Gene Information mouse ... HNRNPM(76936) |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| form lyophilized powder | form lyophilized powder | form lyophilized powder | form lyophilized powder |
| description targeting mouse LOC546967 | description - | description - | description - |
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
11 - Combustible Solids
wgk_germany
WGK 1
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
