Skip to Content
MilliporeSigma
All Photos(6)

Key Documents

HPA055150

Sigma-Aldrich

Anti-PRM1 antibody produced in rabbit

enhanced validation

Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution

Synonym(s):

Anti-CT94.1, Anti-protamine 1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352203
Human Protein Atlas Number:
NACRES:
NA.41

Pricing and availability is not currently available.

biological source

rabbit

Quality Level

conjugate

unconjugated

antibody form

affinity isolated antibody

antibody product type

primary antibodies

clone

polyclonal

product line

Prestige Antibodies® Powered by Atlas Antibodies

form

buffered aqueous glycerol solution

species reactivity

human

enhanced validation

orthogonal RNAseq
Learn more about Antibody Enhanced Validation

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU060761EHU150751EHU045831
esiRNA cDNA target sequence

GCAACGTGCTTGTCATGTTCGGCATCGTCCGGTACACTAAGATGAAGACGGCCACCAACATCTACATCTTCAACCTGGCCTTAGCCGATGCGCTGGCCACCAGCACGCTGCCTTTCCAGAGTGCCAAGTACCTGATGGAGACGTGGCCCTTCGGCGAGCTGCTCTGCAAGGCTGTGCTCTCCATCGACTACTACAATATGTTCACCAGCATCTTCACGCTCACCATGATGAGTGTTGACCGCTACATCGCTGTCTGCCACCCTGTCAAGGCCCTGGACTTCCGCACGCCTGCCAAGGCCAAGCTGATCAACATCTGTATCTGGGTCCTGGCCTCAGGCGTTGGCGTGCCCATCATGGTCATGGCTGTGACCCGTCCCCGGGACGGGGCAGTGGTGTGCATGCTCCAGTTCCCCAGCCCCAGCTGGTACTGGGACACGGTGACCAAGATCTGCGTGTTC

esiRNA cDNA target sequence

TATCTACGGCAGCCACCTTCAGGGCAACCTGTCCCTCCTGAGCCCCAACCACAGTCTGCTGCCCCCGCATCTGCTGCTCAATGCCAGCCACGGCGCCTTCCTGCCCCTCGGGCTCAAGGTCACCATCGTGGGGCTCTACCTGGCCGTGTGTGTCGGAGGGCTCCTGGGGAACTGCCTTGTCATGTACGTCATCCTCAGGCACACCAAAATGAAGACAGCCACCAATATTTACATCTTTAACCTGGCCCTGGCCGACACTCTGGTCCTGCTGACGCTGCCCTTCCAGGGCACGGACATCCTCCTGGGCTTCTGGCCGTTTGGGAATGCGCTGTGCAAGACAGTCATTGCCATTGACTACTACAACATGTTCACCAGCACCTTCACCCTAACTGCCATGAGTGTGGATCGCTATGTAGCCA

esiRNA cDNA target sequence

CAGGCCCTTTCAGAAGCTAACAGAAGGCTATGGATGGAAGCCATGGATGGGAAAGAACCTATCTACCACAGCCCTATAACAAAACAGCAAGAAATGGAGCTAAATGAAGTGGGCTTCAAGTTTGTCAGGAAGTGCATCAATATTATTGAGACCAAAGGGATCAAGACAGAAGGGTTGTACCGCACTGTGGGCAGCAATATTCAGGTTCAGAAGCTGCTGAATGCCTTTTTTGATCCTAAATGCCCAGGAGATGTTGATTTTCATAATAGTGACTGGGACATTAAGACAATCACCAGCTCCTTGAAATTCTACCTCAGGAATCTTTCTGAACCTGTCATGACCTATAGACTTCACAAAGAGCTGGTCTCTGCTGCCAAGTCTGACAACCTGGATTACCGCCTAGGAGCTATTCACTCCCTGGTATATAAGCTACCAGAAAAGAACCGAGAGATGCTGGA

esiRNA cDNA target sequence

GGCTTTGGCAGATGCTTTAGTTACTACAACCATGCCCTTTCAGAGTACGGTCTACTTGATGAATTCCTGGCCTTTTGGGGATGTGCTGTGCAAGATAGTAATTTCCATTGATTACTACAACATGTTCACCAGCATCTTCACCTTGACCATGATGAGCGTGGACCGCTACATTGCCGTGTGCCACCCCGTGAAGGCTTTGGACTTCCGCACACCCTTGAAGGCAAAGATCATCAATATCTGCATCTGGCTGCTGTCGTCATCTGTTGGCATCTCTGCAATAGTCCTTGGAGGCACCAAAGTCAGGGAAGACGTCGATGTCATTGAGTGCTCCTTGCAGTTCCCAGATGATGACTACTCCTGGTGGGACCTCTTCATGAAGATCTGCGTCTTCATCTTTGCCTTCGTGATCCCTGTCCTCATCATCATCGTCTGCTACACCCTGATGATCCTGCGTCTCAA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | human accession no.

ENSG00000116329

Ensembl | human accession no.

ENSG00000125510

Ensembl | human accession no.

ENSG00000079482

Ensembl | human accession no.

ENSG00000082556

Gene Information

human ... OPRD1(4985), OPRD1(4985)

Gene Information

human ... OPRL1(4987), OPRL1(4987)

Gene Information

human ... OPHN1(4983), OPHN1(4983)

Gene Information

human ... OPRK1(4986), OPRK1(4986)

NCBI accession no.

NM_000911

NCBI accession no.

NM_182647

NCBI accession no.

NM_002547

NCBI accession no.

NM_000912

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

Immunogen

protamine 1 recombinant protein epitope signature tag (PrEST)

Application

All Prestige Antibodies Powered by Atlas Antibodies are developed and validated by the Human Protein Atlas (HPA) project and as a result, are supported by the most extensive characterization in the industry.

The Human Protein Atlas project can be subdivided into three efforts: Human Tissue Atlas, Cancer Atlas, and Human Cell Atlas. The antibodies that have been generated in support of the Tissue and Cancer Atlas projects have been tested by immunohistochemistry against hundreds of normal and disease tissues and through the recent efforts of the Human Cell Atlas project, many have been characterized by immunofluorescence to map the human proteome not only at the tissue level but now at the subcellular level. These images and the collection of this vast data set can be viewed on the Human Protein Atlas (HPA) site by clicking on the Image Gallery link. We also provide Prestige Antibodies® protocols and other useful information.

Features and Benefits

Prestige Antibodies® are highly characterized and extensively validated antibodies with the added benefit of all available characterization data for each target being accessible via the Human Protein Atlas portal linked just below the product name at the top of this page. The uniqueness and low cross-reactivity of the Prestige Antibodies® to other proteins are due to a thorough selection of antigen regions, affinity purification, and stringent selection. Prestige antigen controls are available for every corresponding Prestige Antibody and can be found in the linkage section.

Every Prestige Antibody is tested in the following ways:
  • IHC tissue array of 44 normal human tissues and 20 of the most common cancer type tissues.
  • Protein array of 364 human recombinant protein fragments.

Linkage

Corresponding Antigen APREST85761

Physical form

Solution in phosphate buffered saline, pH 7.2, containing 40% glycerol and 0.02% sodium azide.

Legal Information

Prestige Antibodies is a registered trademark of Merck KGaA, Darmstadt, Germany

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Serap Ejder Apay et al.
Pain management nursing : official journal of the American Society of Pain Management Nurses, 13(4), 236-240 (2012-11-20)
The purpose of this study was to investigate the effect of aromatherapy massage on dysmenorrhea. The study used a quasiexperimental design with the subjects as their own control. Every participant applied both aromatherapy massage with lavender oil and placebo massage
Lucian Hritcu et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 19(6), 529-534 (2012-03-10)
Lavender is reported to be an effective medical plant in treating inflammation, depression, stress and mild anxiety in Europe and the USA. The present study investigated the effects of two different lavender essential oils from Lavandula angustifolia ssp. angustifolia Mill.
Buğra Ocak
Journal of environmental management, 100, 22-28 (2012-03-01)
In the world, approximately 600,000 metric tonnes of chromium-containing solid wastes are generated by the leather industry each year. Environmental concerns and escalating landfill costs are becoming increasingly serious problems to the leather industry and seeking solutions to these problems
Mizuho Takahashi et al.
Natural product communications, 6(11), 1769-1774 (2012-01-10)
Essential oils have traditionally been used for decades to alleviate the symptoms of various mental problems. In terms of anxiolytic-like properties, lavender oil is probably the most commonly used and best-studied essential oil. Although there is compositional variance among the
B Uehleke et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 19(8-9), 665-671 (2012-04-06)
Silexan, a novel lavender oil preparation for oral use, has been authorized in Germany for the treatment of states of restlessness during anxious mood. An open-label, exploratory trial was performed to assess the potential of the medicinal product in the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service