Skip to Content
MilliporeSigma
All Photos(9)

Key Documents

ZRB1730

Sigma-Aldrich

Anti-Rab5A Antibody, clone 3L17 ZooMAb® Rabbit Monoclonal

enhanced validation
greener alternative

recombinant, expressed in HEK 293 cells

Synonym(s):

Ras-related protein Rab-5A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352203
NACRES:
NA.43

Pricing and availability is not currently available.

biological source

rabbit

Quality Level

recombinant

expressed in HEK 293 cells

conjugate

unconjugated

antibody form

purified antibody

antibody product type

primary antibodies

clone

3L17, recombinant monoclonal

description

recombinant, expressed in HEK 293 cells

product line

ZooMAb® learn more

form

lyophilized

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU001411EHU009431EHU017091
esiRNA cDNA target sequence

TGGTTGTGCTGCTGCTATTCATCATCTGCTGGCTGCCCTTCCAGATCAGCACCTTCCTGGATACGCTGCATCGCCTCGGCATCCTCTCCAGCTGCCAGGACGAGCGCATCATCGATGTAATCACACAGATCGCCTCCTTCATGGCCTACAGCAACAGCTGCCTCAACCCACTGGTGTACGTGATCGTGGGCAAGCGCTTCCGAAAGAAGTCTTGGGAGGTGTACCAGGGAGTGTGCCAGAAAGGGGGCTGCAGGTCAGAACCCATTCAGATGGAGAACTCCATGGGCACACTGCGGACCTCCATCTCCGTGGAACGCCAGATTCACAAACTGCAGGACTGGGCAGGGAGCAGACAGTGAGCAAACGCCAGCAGGGCTGCTGTGAATTTGTGTAAGGATTGAGGGACAGTTGCTTTTCAGCATGGGCCCAGGAATGCCAAGGAGACATCTATGCACGACCTTGGGAAATGAGT

esiRNA cDNA target sequence

CGAAAAGCGTTCTCTTCACCCCAGGAAGAAGAAGAAGCTGGATTTACTGGGCGCAGAATGAATTCCAAGATGCAGGTGTATTCTGGTTCCAAGTGTGCCTATCTCCCTAAAATGATGACCTTGCACCAGCAATGCATCCGAGTACTTAAAAACAACATCGATTCAATCTTTGAAGTGGGAGGAGTCCCATACTCTGTTCTTGAACCCGTTTTGGAGAGGTGTACACCTGATCAGCTGTATCGCATAGAGGAATACAATCATGTATTAATTGAAGAAACAGATCAATTATGGAAAGTTCATTGTCACCGAGACTTTAAGGAAGAAAGACCCGAAGAGTATGAGTCGTGGCGAGAGATGTACCTGCGGCTTCAGGACGCCCGAGAGCAGCGGCTACGAGTACTAACAAAGAATATCCAGTTCGCACATGCCAATAAGCCCAAAG

esiRNA cDNA target sequence

CCGAGGGAAACAAGAAAACATCAAAGAGGTCTAGCAAAGGGCGCAAACCAGAAGAAGAGGGTGTGGAAGATAACGGGCTGGAGGAAAACTCTGGGGATGGACAGGAGGATGTTGAGACCAGTCTGGAGAACTTGCAGGACATCGACATCATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCAGATTGTGTCGAAGACGATGATGCTGATAACCTCCAGGAGTCCCTGTCGGATAGTAGAGAGCTAGTCGAGGGGGAAATGAAAGAGCTTCCGGAGCAGCTTCAGGAACATGCTATAGAGGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAAATTGAAGAGCCATCCCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAA

esiRNA cDNA target sequence

GCCAATAAAGATCGCCTGAATTCTGCTATTATCTATGACCGAGATTTCTCTTACAATTACTTCGGCTTTAAGACGCTAGAGCGGTCTTATTTGTTGAAGATCAATGGAAAAGTGGCTGAAAGACCACAACATATGTTGATGAGAGTATCTGTTGGGATCCACAAAGAAGACATTGATGCAGCAATTGAAACATATAATCTTCTTTCTGAGAGGTGGTTTACTCATGCTTCGCCCACTCTCTTCAATGCTGGTACCAACCGCCCACAACTTTCTAGCTGTTTTCTTCTGAGTATGAAAGATGACAGCATTGAAGGCATTTATGACACTCTAAAGCAATGTGCATTGATTTCTAAGTCTGCTGGAGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCTACTGGCAGCTACATTGCTGGGACTAATGGC

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | human accession no.

ENSG00000168398

Ensembl | human accession no.

ENSG00000011007

Ensembl | human accession no.

ENSG00000160633

Ensembl | human accession no.

ENSG00000167325

Gene Information

human ... BDKRB2(624), BDKRB2(624)

Gene Information

human ... TCEB3(6924), TCEB3(6924)

Gene Information

human ... SAFB(6294), SAFB(6294)

Gene Information

human ... RRM1(6240), RRM1(6240)

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

We are committed to bringing you greener alternative products, which adhere to one or more of The 12 Principles of Green Chemistry.This antibody is Preservative-free, produced without the harm or sacrifice of animals and exceptionally stable to allow for ambient shipping and storage if needed and thus aligns with "Waste Prevention", "Designing Safer Chemicals" and "Design for Energy Efficiency". Click here for more information.
ZooMAb® antibodies represent an entirely new generation of recombinant monoclonal antibodies.

Each ZooMAb® antibody is manufactured using our proprietary recombinant expression system, purified to homogeneity, and precisely dispensed to produce robust and highly reproducible lot-to-lot consistency. Only top-performing clones are released for use by researchers. Each antibody is validated for high specificity and affinity across multiple applications, including its most commonly used application. ZooMAb® antibodies are reliably available and ready to ship when you need them.

Specificity

Clone 3L17 is a ZooMAb® Rabbit recombinant monoclonal antibody that specifically detects Ras-related protein Rab5A. It targets an epitope within 16 amino acids from the C-terminal region.

Immunogen

KLH-conjugated linear peptide corresponding to 16 amino acids from the C-terminal region of human Ras-related protein Rab5A.

Application

Quality Control Testing

Evaluated by Western Blotting in Neuro2a cell lysate.

Western Blotting Analysis: A 1:1,000 dilution of this antibody detected Rab5A in Neuro2a cell lysate.

Tested applications

Western Blotting Analysis: A 1:1,000 dilution from a representative lot detected Rab5A in lysates from A431, MCF7, PC12 cells and Rat brain tissue.

Immunocytochemistry Analysis: A 1:100 dilution from a representative lot detected Rab5A in MCF-7 cells.

Affinity Binding Assay: A representative lot of this antibody bound Rab5 with a KD of 5.1 x 10-6 in an affinity binding assay.

Note: Actual optimal working dilutions must be determined by end user as specimens, and experimental conditions may vary with the end user

Target description

Ras-related protein Rab-5A (UniProt: P20+D9339; also known as EC:3.6.5.2, Rab5A) is encoded by the RAB5A (also known as RAB5) gene (Gene ID: 5868) in human. Rab5A is a member of the small GTPase superfamily that is localized in the cytosolic side of plasma membrane and endosomes. It plays important roles in cellular differentiation, neurogenesis, exocytosis, and protein transport. It is a rate-limiting catalyst of the endocytic uptake and delivery to early endosomes of both fluid-phase and receptor-mediated endocytic tracers, as well as of homotypic endosomal fusion. It is required for endosome fusion with the plasma membrane. It localizes to early endosomes where it is involved in the recruitment of RAB7A and the maturation of these compartments to late endosomes. It drives the maturation of endosomes by transporting vacuolar (H+)-ATPases from trans-Golgi network to endocytic vesicles. Rab5A cycles between active GTP-bound and inactive GDP-bound states. In its active state, it binds to a variety of effector proteins to regulate cellular responses such as of intracellular membrane trafficking and from the formation of transport vesicles and their fusion with membranes. Active GTP-bound form recruits different sets of downstream effectors to membrane that are directly responsible for vesicle formation, movement, tethering, and fusion. This ZooMAb® recombinant monoclonal antibody, generated by our propriety technology, offers significantly enhanced specificity, affinity, reproducibility, and stability over conventional monoclonals. (Ref.: Croizet-Berger, K., et al. (2002). Proc. Natl. Acad. Sci. USA. 99 (12); 8277-8282; Hoffenberg, S., et al. (2000). J. Biol. Chem. 275(32); 24661-24669).

Physical form

Purified recombinant rabbit monoclonal antibody IgG, lyophilized in PBS with 5% Trehalose, normal appearance a coarse or translucent resin. The PBS/trehalose components in the ZooMAb formulation can have the appearance of a semi-solid (bead like gel) after lyophilization. This is a normal phenomenon. Please follow the recommended reconstitution procedure in the data sheet to dissolve the semi-solid, bead-like, gel-appearing material. The resulting antibody solution is completely stable and functional as proven by full functional testing. Contains no biocide or preservatives, such as azide, or any animal by-products. Larger pack sizes provided as multiples of 25 μL.

Reconstitution

Reconstitute lyophilized antibody pellet with 25μL of ultrapure water or Phosphate Buffered Saline (PBS). Please refer to our reconstitution protocol and the specific application guidance on the suggested starting dilutions and sample type.

Storage and Stability

Recommend storage of lyophilized product at 2-8°C; Before reconstitution, micro-centrifuge vials briefly to spin down material to bottom of the vial; Reconstitute each vial by adding 25 μL of filtered lab grade water or PBS; Reconstituted antibodies can be stored at 2-8°C, or -20°C for long term storage. Avoid repeated freeze-thaws.

Legal Information

ZooMAb is a registered trademark of Merck KGaA, Darmstadt, Germany

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service